View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1096_low_23 (Length: 202)

Name: NF1096_low_23
Description: NF1096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1096_low_23
NF1096_low_23
[»] chr3 (1 HSPs)
chr3 (26-187)||(12354654-12354816)


Alignment Details
Target: chr3 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 26 - 187
Target Start/End: Complemental strand, 12354816 - 12354654
Alignment:
Q  26 tataacgactgctccccaatagtgatcaatagcatcagtttgttaaattctttttccatctcctggaatttttagggcaggtggagtttgagaaaacttt 125  Q
    ||||| |||||||||||||||||||||| ||||||||||||||  |||||||||||||||||||||||||||| |||||||||||||||||| || ||||    
T  12354816 tataaggactgctccccaatagtgatcactagcatcagtttgtagaattctttttccatctcctggaatttttggggcaggtggagtttgagcaaccttt 12354717  T
Q  126 ttcaagattttaactgcttcagtttgttttattccccat-gtggaggatttttcttgagcaac 187  Q
    ||||||||||||| |||||| |||| |||| ||||  || |||||||||||||||||||||||    
T  12354716 ttcaagattttaattgcttcggtttattttgttccagatggtggaggatttttcttgagcaac 12354654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University