View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10962_low_11 (Length: 237)

Name: NF10962_low_11
Description: NF10962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10962_low_11
NF10962_low_11
[»] chr5 (1 HSPs)
chr5 (13-222)||(3532175-3532378)


Alignment Details
Target: chr5 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 13 - 222
Target Start/End: Original strand, 3532175 - 3532378
Alignment:
Q  13 cagaagaaaagtgaaataatgtgattgatgcaggagctatttttggggagattctctacnnnnnnnncgtaaaaattatattcttactttgtctttattt 112  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        | | |||||||||||||||||||||||||||||    
T  3532175 cagaagaaaagtgaaataatgtgattgatgcaggagctatttttggggagattctctacttttttttcatcaaaattatattcttactttgtctttattt 3532274  T
Q  113 gatccatatctgtcaaatcttaattactcttcaaagagagtctttttgagttgctttagagagtttaagggatgcaattgtgacaatatataccactatc 212  Q
    ||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||    |||||||||||    
T  3532275 gatccatatctgtcaaatcttaattactcttcaa--agagtctttttgagttgctttagagagtttaagggatgcaattgtgaca----ataccactatc 3532368  T
Q  213 ctttaattgt 222  Q
    || |||||||    
T  3532369 ctataattgt 3532378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University