View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10957_high_75 (Length: 238)

Name: NF10957_high_75
Description: NF10957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10957_high_75
NF10957_high_75
[»] chr2 (1 HSPs)
chr2 (71-223)||(33728156-33728308)
[»] chr8 (1 HSPs)
chr8 (71-127)||(20702018-20702074)


Alignment Details
Target: chr2 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 71 - 223
Target Start/End: Original strand, 33728156 - 33728308
Alignment:
Q  71 gcagctagatgattgggttctatgtcgtatctacaagaaaaattcaagcgcacaaaaacctattccaaacggcgtcatttcaagcagggaatacactcaa 170  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33728156 gcagctagatgattgggttctatgtcgtatctacaagaaaaattcaagtgcacaaaaacctattccaaacggcgtcatttcaagcagggaatacactcaa 33728255  T
Q  171 tacagcaacggttcatcgtcttcttcatcatcccacctcgacgacgttcttga 223  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33728256 tacagcaacggttcatcgtcttcttcatcatcccacctcgacgacgttcttga 33728308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 71 - 127
Target Start/End: Original strand, 20702018 - 20702074
Alignment:
Q  71 gcagctagatgattgggttctatgtcgtatctacaagaaaaattcaagcgcacaaaa 127  Q
    |||||| |||||||||||| | ||||| || ||||||||||| |||||| |||||||    
T  20702018 gcagcttgatgattgggttttgtgtcgaatatacaagaaaaactcaagctcacaaaa 20702074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University