View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10954A_low_741 (Length: 202)

Name: NF10954A_low_741
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10954A_low_741
NF10954A_low_741
[»] chr5 (1 HSPs)
chr5 (22-187)||(35489754-35489919)
[»] chr1 (2 HSPs)
chr1 (78-179)||(14233080-14233181)
chr1 (78-179)||(14242754-14242855)


Alignment Details
Target: chr5 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 22 - 187
Target Start/End: Complemental strand, 35489919 - 35489754
Alignment:
Q  22 ggaagtatgattgctatcaaacttggagttagcggtgaaggctcgtttacaaaaaccgaagctgatcttctcttagtctttatatgtctatatgttgcgg 121  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  35489919 ggaagtatgattgctatcaaacttggagttagcggtgaaggctcgtttacaaaaactgaagctgatcttctcttagtctttatatgtctatatgttgcgg 35489820  T
Q  122 catttgcatggtcttggggtgcgttgggatggttagttcctagtgaaatatgctctcttgatgtcc 187  Q
    ||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||| ||||    
T  35489819 catttgcatggtcttggggtgcgctgggatggttagttcccagtgaaatatgctctcttgaagtcc 35489754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 50; Significance: 8e-20; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 78 - 179
Target Start/End: Original strand, 14233080 - 14233181
Alignment:
Q  78 cgaagctgatcttctcttagtctttatatgtctatatgttgcggcatttgcatggtcttggggtgcgttgggatggttagttcctagtgaaatatgctct 177  Q
    |||||| || ||||||||  ||||||| |||  ||||||||||||||||||||||||||||||  | ||||| |||||||| ||||||||||||||| ||    
T  14233080 cgaagccgaccttctcttgttctttatttgtgcatatgttgcggcatttgcatggtcttggggaccattgggttggttagtgcctagtgaaatatgcgct 14233179  T
Q  178 ct 179  Q
    ||    
T  14233180 ct 14233181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 78 - 179
Target Start/End: Original strand, 14242754 - 14242855
Alignment:
Q  78 cgaagctgatcttctcttagtctttatatgtctatatgttgcggcatttgcatggtcttggggtgcgttgggatggttagttcctagtgaaatatgctct 177  Q
    |||||| || ||||||||  ||||||| |||  ||||||||||||||||||||||||||||||  | ||||| |||||||| ||||||||| ||||| ||    
T  14242754 cgaagccgaccttctcttgttctttatttgtgcatatgttgcggcatttgcatggtcttggggaccattgggttggttagtgcctagtgaagtatgcgct 14242853  T
Q  178 ct 179  Q
    ||    
T  14242854 ct 14242855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University