View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10954A_low_717 (Length: 208)

Name: NF10954A_low_717
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10954A_low_717
NF10954A_low_717
[»] chr8 (1 HSPs)
chr8 (18-188)||(31111204-31111374)
[»] chr3 (1 HSPs)
chr3 (155-187)||(26006960-26006992)


Alignment Details
Target: chr8 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 18 - 188
Target Start/End: Original strand, 31111204 - 31111374
Alignment:
Q  18 aatataaaatatatggctattgaacggtattgggaatcttattatcaatatcttaccccaaccaaaacccaatagaaaatcacaccaatgtgattaggag 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  31111204 aatataaaatatatggctattgaacggtattgggaatcttattatcaatatcttaccccaaccaaaacccaatagaaaatcacaccaatgtgattaggag 31111303  T
Q  118 acggggcacttttgtccctagcaatgtggcattgatgtggagtccacgtcaagtatcacatcttcatttag 188  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  31111304 acggggcacttttgtccctagcaatgtggcattgatgtggagtccacgtcaagtatcacatcttcatttag 31111374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 155 - 187
Target Start/End: Original strand, 26006960 - 26006992
Alignment:
Q  155 tggagtccacgtcaagtatcacatcttcattta 187  Q
    ||||||||||||||||| |||||||||||||||    
T  26006960 tggagtccacgtcaagtgtcacatcttcattta 26006992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University