View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10954A_low_579 (Length: 229)

Name: NF10954A_low_579
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10954A_low_579
NF10954A_low_579
[»] chr2 (1 HSPs)
chr2 (1-229)||(39718042-39718270)
[»] chr4 (1 HSPs)
chr4 (181-229)||(22549920-22549968)


Alignment Details
Target: chr2 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 39718270 - 39718042
Alignment:
Q  1 atttagcatgattcagtgtttatcttttttgaggcctaagtatcttcaaaattggaatgttagtgaaatatatctattatagtacgtcgaagtggttcag 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  39718270 atttagcatgattcagtgtttatcttttttgaggcctaagtatcttcaaaattggaatgttagtgaaatatatctattatagtacgtcgaagtggttcag 39718171  T
Q  101 agacttacaataccctttacnnnnnnnnnnnnnnnnnctgctaatacctaatagttctttttggtttcgtccagaagcttggaatcttcatggagatgct 200  Q
    ||||||||||||||||||||                 ||||||||| ||||||||||||||||||||| ||||||||||||||| |||||||||||||||    
T  39718170 agacttacaataccctttacttttctttttcttttttctgctaatatctaatagttctttttggtttcttccagaagcttggaagcttcatggagatgct 39718071  T
Q  201 atttggcgggcgctatgtgattcttttga 229  Q
    |||||||||||||||||||||||||||||    
T  39718070 atttggcgggcgctatgtgattcttttga 39718042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 229
Target Start/End: Original strand, 22549920 - 22549968
Alignment:
Q  181 ggaatcttcatggagatgctatttggcgggcgctatgtgattcttttga 229  Q
    |||| ||| ||||||||| ||||||| |||||||||||| |||||||||    
T  22549920 ggaagctttatggagatgttatttggtgggcgctatgtgcttcttttga 22549968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University