View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10954A_low_520 (Length: 233)

Name: NF10954A_low_520
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10954A_low_520
NF10954A_low_520
[»] chr3 (2 HSPs)
chr3 (9-108)||(41957823-41957922)
chr3 (173-214)||(41957715-41957756)


Alignment Details
Target: chr3 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 9 - 108
Target Start/End: Complemental strand, 41957922 - 41957823
Alignment:
Q  9 gacatcaggatatgataagttaatgttgaatattattccattttgccactttagattaaattttatttctgaatgagagttgcgttaactaaccagatag 108  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |  |||||||||||||||||    
T  41957922 gacatcaggatatgataagttaatgttgaatattattccattttgccactttagtttaaattttatttctgaatgagagctctgttaactaaccagatag 41957823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 173 - 214
Target Start/End: Complemental strand, 41957756 - 41957715
Alignment:
Q  173 catatctatcattcttttttaagaaccataacgtgattttga 214  Q
    |||||| |||||||||||||||||||||||||||||||||||    
T  41957756 catatccatcattcttttttaagaaccataacgtgattttga 41957715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University