View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10954A_low_467 (Length: 241)

Name: NF10954A_low_467
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10954A_low_467
NF10954A_low_467
[»] chr3 (1 HSPs)
chr3 (19-191)||(21140116-21140286)


Alignment Details
Target: chr3 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 19 - 191
Target Start/End: Original strand, 21140116 - 21140286
Alignment:
Q  19 tcaggtatcaattagatcattgctatatgactaattgtactatatactcaaaaaattacacnnnnnnngtactattcatacatcccaaaggccttcnnnn 118  Q
    |||||||||||| ||||||||||||||||||||||||||||| ||||||| ||||||||||       | ||||||||||||||||||||||||||        
T  21140116 tcaggtatcaataagatcattgctatatgactaattgtactacatactcagaaaattacactttttttgcactattcatacatcccaaaggccttc-ttt 21140214  T
Q  119 nnnaattttgattaagaaaattacactttaactccctcttgtgtcctaaacatagagggaagtagtttttgcc 191  Q
       ||||||||||||||||||||||| |||||||||||||||||||||||||| ||| | || ||||||||||    
T  21140215 tttaattttgattaagaaaattacac-ttaactccctcttgtgtcctaaacatggagcggaggagtttttgcc 21140286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University