View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10954A_low_384 (Length: 249)

Name: NF10954A_low_384
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10954A_low_384
NF10954A_low_384
[»] scaffold0036 (1 HSPs)
scaffold0036 (24-234)||(115171-115381)


Alignment Details
Target: scaffold0036 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: scaffold0036
Description:

Target: scaffold0036; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 24 - 234
Target Start/End: Original strand, 115171 - 115381
Alignment:
Q  24 aggatttcatagctcaattggtttgagctaagtcagctaacgggttgaagaagttgggggaattaatagaccgaggttcaaaccctggtgaaggagaaaa 123  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  115171 aggatttcatagctcaattggtttgagctaagtcagctaacgggttgaagaagttgggggaattaatagaccgaggttcaaaccctggtgaaggagaaaa 115270  T
Q  124 tagtaatgtaaaaactaattcactagcattttcagatcaaaagaaaacagataaataatttatgtcaatcaccgattcaccattctaaatcatttgacag 223  Q
    |||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  115271 tagtaatgtaaaaactaattcactaggatttgcagatcaaaagaaaacagataaataatttatgtcaatcaccgattcaccattctaaatcatttgacag 115370  T
Q  224 gacacggtaat 234  Q
    |||||||||||    
T  115371 gacacggtaat 115381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University