View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10954A_low_316 (Length: 258)

Name: NF10954A_low_316
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10954A_low_316
NF10954A_low_316
[»] chr7 (1 HSPs)
chr7 (1-240)||(39932532-39932771)
[»] chr4 (2 HSPs)
chr4 (1-139)||(18148679-18148822)
chr4 (72-118)||(49069066-49069112)


Alignment Details
Target: chr7 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 39932771 - 39932532
Alignment:
Q  1 tcgattcataacttttcaaacacatgtttatttgaactccctttacctgtaggaatatgtcttggatatgtcgattgtgttatgggcggagtcctattca 100  Q
    ||||||||||||||||||||||||| |||||| |||||||||||||||||||||||| ||||||||||||||||| |||||| |||||||||||||||||    
T  39932771 tcgattcataacttttcaaacacatatttattcgaactccctttacctgtaggaatacgtcttggatatgtcgatcgtgttacgggcggagtcctattca 39932672  T
Q  101 tggggacatggtagaattgagagaagttgtaggtattatgtcgagtctcttgttgcccctgttaaggaacttgtcttcactcgagagatgcaacaattaa 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  39932671 tggggacatggtagaattgagagaagttgtaggtattatgtcgagtctcttgttgcccctgttaaggaacttgtcttcactcgagaaatgcaacaattaa 39932572  T
Q  201 gataaatgtgtcttgatttgaaaatattttctcaatgcat 240  Q
    |||||||||||||||||||||||||||||||| |||||||    
T  39932571 gataaatgtgtcttgatttgaaaatattttcttaatgcat 39932532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 139
Target Start/End: Complemental strand, 18148822 - 18148679
Alignment:
Q  1 tcgattcataacttttcaaacaca-----tgtttatttgaactccctttacctgtaggaatatgtcttggatatgtcgattgtgttatgggcggagtcct 95  Q
    ||||||||||||||||||||||||     | |||||| |||| ||||||||||||||||||| ||||||||| || ||||||||||||||||||||||||    
T  18148822 tcgattcataacttttcaaacacaaccaatatttattcgaaccccctttacctgtaggaatacgtcttggatctgccgattgtgttatgggcggagtcct 18148723  T
Q  96 attcatggggacatggtagaattgagagaagttgtaggtattat 139  Q
    |||||||||||| ||||||||||| |||||| ||||||||||||    
T  18148722 attcatggggacctggtagaattgggagaagctgtaggtattat 18148679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 72 - 118
Target Start/End: Original strand, 49069066 - 49069112
Alignment:
Q  72 cgattgtgttatgggcggagtcctattcatggggacatggtagaatt 118  Q
    ||||| |||||||||||||||||||||||||||||| ||||||||||    
T  49069066 cgattatgttatgggcggagtcctattcatggggacctggtagaatt 49069112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University