View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10954A_low_290 (Length: 266)

Name: NF10954A_low_290
Description: NF10954A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10954A_low_290
NF10954A_low_290
[»] chr6 (3 HSPs)
chr6 (7-213)||(23332595-23332801)
chr6 (208-250)||(23322331-23322373)
chr6 (208-250)||(23332498-23332540)


Alignment Details
Target: chr6 (Bit Score: 191; Significance: 1e-104; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 7 - 213
Target Start/End: Complemental strand, 23332801 - 23332595
Alignment:
Q  7 ctgagatgaagggtttctataaggtagatcgtggtgcgtgggtcaccctgacttatgtacagccgaatcttctagatatgactatcgcagagagatcagg 106  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
T  23332801 ctgagctgaagggtttctataaggtagatcgtggtgcgtgggtcaccctgacgtatgtacagccgaatcttctagatatgactatcgcagagagatcagg 23332702  T
Q  107 agtcgaaatcaactatcctaacaaatttcttcctcccatgtcgaaaatgattgtccaacgtgagggtggatcggtcatgcgcttctatcgctcattcgtc 206  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  23332701 agtcgaaatcaactatcctaacaaatttcttcctcccatgtcgaaaatgattgtcccacgtgagggtggatcggtcatgcgcttctatcgctcattcgtc 23332602  T
Q  207 cacatat 213  Q
    || ||||    
T  23332601 catatat 23332595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 208 - 250
Target Start/End: Complemental strand, 23322373 - 23322331
Alignment:
Q  208 acatatgcgtttggattttacaacgattgtgtttggtgatgtc 250  Q
    ||||||||||||||| ||||||||| |||||||||||||||||    
T  23322373 acatatgcgtttggagtttacaacgtttgtgtttggtgatgtc 23322331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 208 - 250
Target Start/End: Complemental strand, 23332540 - 23332498
Alignment:
Q  208 acatatgcgtttggattttacaacgattgtgtttggtgatgtc 250  Q
    ||||||||||||||| ||||||||| |||||||||||||||||    
T  23332540 acatatgcgtttggagtttacaacgtttgtgtttggtgatgtc 23332498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University