View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1094_low_17 (Length: 203)

Name: NF1094_low_17
Description: NF1094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1094_low_17
NF1094_low_17
[»] chr7 (4 HSPs)
chr7 (1-106)||(20338002-20338107)
chr7 (1-75)||(20141708-20141782)
chr7 (1-67)||(20134206-20134272)
chr7 (1-76)||(20127028-20127103)


Alignment Details
Target: chr7 (Bit Score: 102; Significance: 7e-51; HSPs: 4)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 102; E-Value: 7e-51
Query Start/End: Original strand, 1 - 106
Target Start/End: Complemental strand, 20338107 - 20338002
Alignment:
Q  1 tgaattttggtgacgtgatggtaggacgctgtgatggtgataggagactcatgatgggatttttgttgcaaatgtttggagaattggagagtagaaaggt 100  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  20338107 tgaatttcggtgacgtgatggtaggacgctgtgatggtgataggagactcatgatgggatttttgttgcaaatgtttggagaattggagagtagaaaggt 20338008  T
Q  101 tgaaag 106  Q
    ||||||    
T  20338007 tgaaag 20338002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 75
Target Start/End: Original strand, 20141708 - 20141782
Alignment:
Q  1 tgaattttggtgacgtgatggtaggacgctgtgatggtgataggagactcatgatgggatttttgttgcaaatgt 75  Q
    |||||||||||| | |||||||||||||| |||||||||||||| || ||||||||||||||||||| |||||||    
T  20141708 tgaattttggtggcatgatggtaggacgccgtgatggtgataggtgattcatgatgggatttttgttacaaatgt 20141782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 1 - 67
Target Start/End: Original strand, 20134206 - 20134272
Alignment:
Q  1 tgaattttggtgacgtgatggtaggacgctgtgatggtgataggagactcatgatgggatttttgtt 67  Q
    |||||||||||||| || |||||||||| |||||||| ||||||||| |||||||||||||||||||    
T  20134206 tgaattttggtgacatgttggtaggacgttgtgatggagataggagattcatgatgggatttttgtt 20134272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 20127028 - 20127103
Alignment:
Q  1 tgaattttggtgacgtgatggtaggacgctgtgatggtgataggagactcatgatgggatttttgttgcaaatgtt 76  Q
    ||||||||||||||||| |||||| | | |||||||| || ||  || |||| |||||||||||||| ||||||||    
T  20127028 tgaattttggtgacgtggtggtagaatgttgtgatggagaaagaggattcattatgggatttttgttacaaatgtt 20127103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University