View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10944_low_7 (Length: 232)

Name: NF10944_low_7
Description: NF10944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10944_low_7
NF10944_low_7
[»] chr6 (1 HSPs)
chr6 (18-217)||(29092958-29093156)
[»] chr5 (1 HSPs)
chr5 (132-204)||(43286905-43286977)


Alignment Details
Target: chr6 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 18 - 217
Target Start/End: Complemental strand, 29093156 - 29092958
Alignment:
Q  18 tctaaatgtacctacatgcaaggctggcgatggtggcagcgacagaaataggcagtggtttcatgtatttttacatttgtttacactagttcatccttat 117  Q
    |||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||    
T  29093156 tctaaaagtacctacgtgcaaggctggcgatggtggcagcgacagaaataggcagtggtttcatgtatttttacatttgtttacactagt-cttccttat 29093058  T
Q  118 aggttcatgatccgtaaccgtgatttgacatggctcttttggttcattttgagttgcatcttacttgtagcaaggaattaaattactgtgctgtatctct 217  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||    
T  29093057 aggttcatgatccgtaaccatgatttgacatggctcttttggttcattttgagttgtatcttacttggagcaaggaattaaattactgtgctgtatctct 29092958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 132 - 204
Target Start/End: Complemental strand, 43286977 - 43286905
Alignment:
Q  132 taaccgtgatttgacatggctcttttggttcattttgagttgcatcttacttgtagcaaggaattaaattact 204  Q
    ||||| ||||||||||| |||| ||||||||||||||| |||||||||| ||| |||| || |||||| ||||    
T  43286977 taaccatgatttgacattgctcctttggttcattttgatttgcatcttatttggagcatgggattaaaatact 43286905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University