View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10940_high_19 (Length: 207)

Name: NF10940_high_19
Description: NF10940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10940_high_19
NF10940_high_19
[»] chr5 (2 HSPs)
chr5 (42-185)||(13879532-13879675)
chr5 (52-185)||(13875315-13875448)


Alignment Details
Target: chr5 (Bit Score: 144; Significance: 6e-76; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 144; E-Value: 6e-76
Query Start/End: Original strand, 42 - 185
Target Start/End: Complemental strand, 13879675 - 13879532
Alignment:
Q  42 gatgatgatgatcttgttctctgggattttacggagactgaggagtctgtgattttgcggtcgaatcttgtcgctgacaacgtgaggaaggaagagattg 141  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  13879675 gatgatgatgatcttgttctctgggattttacggagactgaggagtctgtgattttgcggtcgaatcttgtcgctgacaacgtgaggaaggaagagattg 13879576  T
Q  142 atgtctgtgttgatcacggtactctcaggattgaggatgttctt 185  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
T  13879575 atgtctgtgttgatcacggtactctcaggattgaggatgttctt 13879532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 52 - 185
Target Start/End: Complemental strand, 13875448 - 13875315
Alignment:
Q  52 atcttgttctctgggattttacggagactgaggagtctgtgattttgcggtcgaatcttgtcgctgacaacgtgaggaaggaagagattgatgtctgtgt 151  Q
    ||||||||||||| ||||||  |||||| ||||||||| ||||||| |||| |||||| |||||  ||||||||||||||||||||||||||||||||||    
T  13875448 atcttgttctctgtgattttgaggagaccgaggagtctttgatttttcggttgaatctggtcgccaacaacgtgaggaaggaagagattgatgtctgtgt 13875349  T
Q  152 tgatcacggtactctcaggattgaggatgttctt 185  Q
    |||||||||||||||||||||| |||||| ||||    
T  13875348 tgatcacggtactctcaggattaaggatgctctt 13875315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University