View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10939_high_8 (Length: 330)

Name: NF10939_high_8
Description: NF10939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10939_high_8
NF10939_high_8
[»] chr1 (2 HSPs)
chr1 (5-220)||(34234221-34234445)
chr1 (281-313)||(34234128-34234160)


Alignment Details
Target: chr1 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 5 - 220
Target Start/End: Complemental strand, 34234445 - 34234221
Alignment:
Q  5 gagaagcagagattaccaaaaaa-caatacaacaattgttcnnnnnnn-gcgattaaagaggtgcaaacatagaaacataatttgaattttgagtaaaat 102  Q
    |||||| |||||||||||||||| |||||||||||||||||        |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34234445 gagaagtagagattaccaaaaaaacaatacaacaattgttcaaaaaaaagcgattaaagaggtgcaaacatagaaacataatttgaattttgagtaaaat 34234346  T
Q  103 tacttgaaaccctaaattgttnnnnnnnn-------tgaattgtaactcaaatttggggggaaacggtagagaaattgattgaattgagagaaatggtac 195  Q
    |||||||||||||||||||||               ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34234345 tacttgaaaccctaaattgttaaaaaaaaataaaaatgaattgtaacacaaatttggggggaaacggtagagaaattgattgaattgagagaaatggtac 34234246  T
Q  196 atagatcttagctggaagtagctac 220  Q
    |||||||||||||||||||||||||    
T  34234245 atagatcttagctggaagtagctac 34234221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 281 - 313
Target Start/End: Complemental strand, 34234160 - 34234128
Alignment:
Q  281 gttaagattcgtgggaatctgaggagcgaagtg 313  Q
    |||||||||||||||||||||||||||||||||    
T  34234160 gttaagattcgtgggaatctgaggagcgaagtg 34234128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University