View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10936_high_9 (Length: 249)

Name: NF10936_high_9
Description: NF10936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10936_high_9
NF10936_high_9
[»] chr4 (1 HSPs)
chr4 (12-249)||(28883512-28883750)


Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 12 - 249
Target Start/End: Original strand, 28883512 - 28883750
Alignment:
Q  12 agagagagggaaaccaattctgttgcaatttatgaacaagaaataacgagatccggatacacgtttatgacagaagtgggccccatcgaaagtagca-at 110  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||| ||    
T  28883512 agagagagggaaaccaattctgttgcaatttatgaacaagaaataacgagatccggatccacgtttattacagaagtgggccccatcgaaagtagcagat 28883611  T
Q  111 ttcatttcaatttcaatctgcattgataaacaaaaccggaacagaattttccgtcaccgacgaagatgctgccaaatctccgatcccggcgacgcccccg 210  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  28883612 ttcatttcaatttcaatctgcattgataaacaaaaccgcaacagaattttccgtcaccgacgaagatgctgccaaatctccgatcccggcgacgcccccg 28883711  T
Q  211 ttacggaggccttctatgtgccgttgtttcagcacttct 249  Q
    ||||||  |||||||||| || || ||||||||||||||    
T  28883712 ttacggcagccttctatgcgctgtcgtttcagcacttct 28883750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University