View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10932_low_26 (Length: 224)

Name: NF10932_low_26
Description: NF10932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10932_low_26
NF10932_low_26
[»] chr4 (1 HSPs)
chr4 (10-206)||(4521426-4521618)


Alignment Details
Target: chr4 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 10 - 206
Target Start/End: Complemental strand, 4521618 - 4521426
Alignment:
Q  10 gagatgaacatggtgctttaatttcatgttaaatttgatcattttgcgttgaagtgtgag-tgcatattggtgaagcatttggattcagctcgtaattga 108  Q
    |||||||||||||||||||     |||||||||||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||||||||||    
T  4521618 gagatgaacatggtgcttt-----catgttaaatttgatcattttgcgttgaagtgtgaggtgcatattggtgaagcttttagattcagctcgtaattga 4521524  T
Q  109 gttcttgagtttaatttgggacttttagactttgaatttgatgctaaggtggtggttgagagcttctcattcaatcggaaaaatttgaatgatttcag 206  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||    
T  4521523 gttcttgagtttaatttgggacttttagactttgaatttgatgctaaggtggtggtcgagagcttctcattcaatcagaaaaatttgaatgatttcag 4521426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University