View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10924_low_4 (Length: 241)

Name: NF10924_low_4
Description: NF10924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10924_low_4
NF10924_low_4
[»] chr4 (1 HSPs)
chr4 (15-222)||(45466436-45466643)
[»] chr7 (1 HSPs)
chr7 (15-222)||(10044324-10044531)


Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 15 - 222
Target Start/End: Original strand, 45466436 - 45466643
Alignment:
Q  15 ataggggagaatttgaagagaggttgaaggctgttttgaaagaagttgaagaagctgaagggaaggttattctttttattgatgagattcatcttgttct 114  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
T  45466436 ataggggagaatttgaagagaggttgaaggctgttttgaaagaagttgaagaagctgaagggaaggttattcttttcattgatgagattcatcttgttct 45466535  T
Q  115 tggagctggtagaacagaaggatcaatggatgctgctaatctttttaagccaatgcttgctcgtggacagcttcgatgtattggtgctacaacacttgag 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  45466536 tggagctggtagaacagaaggatcaatggatgctgctaatctttttaagccaatgcttgctcgtggacagcttcgatgtattggtgctacaacacttgag 45466635  T
Q  215 gagtatag 222  Q
    ||||||||    
T  45466636 gagtatag 45466643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 92; Significance: 8e-45; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 15 - 222
Target Start/End: Original strand, 10044324 - 10044531
Alignment:
Q  15 ataggggagaatttgaagagaggttgaaggctgttttgaaagaagttgaagaagctgaagggaaggttattctttttattgatgagattcatcttgttct 114  Q
    |||||||| |||||||| | ||||||||||| |||||||||||||| ||||| |||||||||||||||||| |||| |||||||| ||||||||||||||    
T  10044324 ataggggacaatttgaacaaaggttgaaggcagttttgaaagaagtggaagatgctgaagggaaggttattgttttcattgatgaaattcatcttgttct 10044423  T
Q  115 tggagctggtagaacagaaggatcaatggatgctgctaatctttttaagccaatgcttgctcgtggacagcttcgatgtattggtgctacaacacttgag 214  Q
     || || |||  |    |||||||||||||||||||||||||||| || || |||||||||||||| || ||| |||| || ||||| |||||||||||     
T  10044424 cggtgccggtcaatgtcaaggatcaatggatgctgctaatcttttgaaacctatgcttgctcgtggccaacttagatgcatcggtgcaacaacacttgat 10044523  T
Q  215 gagtatag 222  Q
    || |||||    
T  10044524 gaatatag 10044531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University