View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10920_high_4 (Length: 377)

Name: NF10920_high_4
Description: NF10920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10920_high_4
NF10920_high_4
[»] chr2 (3 HSPs)
chr2 (185-357)||(14431097-14431269)
chr2 (79-185)||(14430946-14431052)
chr2 (62-103)||(14430734-14430775)


Alignment Details
Target: chr2 (Bit Score: 137; Significance: 2e-71; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 185 - 357
Target Start/End: Original strand, 14431097 - 14431269
Alignment:
Q  185 gttttcgtccccagagctttgactttttcgccgaatttgtaagagaggtttaagttccctttagctttccccgaagacgttctaacctgataattaacca 284  Q
    |||||| || || |||||| |||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| |||||||||||||||||||||     
T  14431097 gttttcatcgccggagcttggactttttcgccgaatttgtaagagaggtttaagtttcctttagctttccctgaagatgttctaacctgataattaacct 14431196  T
Q  285 gccggaaagaatctccggaggtgttatcaagaagctccttgagagggatatgaaccttgccgatcaaggtatc 357  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  14431197 gccggaaagaatctccggaggggttatcaagaagctccttgagagggatatgaaccttgccgatcaaggtatc 14431269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 79 - 185
Target Start/End: Original strand, 14430946 - 14431052
Alignment:
Q  79 tggatatccataaaccggttgttgcagctgaggaggataaggtgtaccatacggcaccgagctagaccccgctgccgccattccaggtggaggataagcc 178  Q
    ||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
T  14430946 tggatatccataacccggttgttgcggctgaggaggataaggtgtaccatacggcaccgagctagacccagctgccgccattccaggtggaggataagcc 14431045  T
Q  179 atcaccg 185  Q
    |||||||    
T  14431046 atcaccg 14431052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 62 - 103
Target Start/End: Original strand, 14430734 - 14430775
Alignment:
Q  62 ttctgtgcttctgccactggatatccataaaccggttgttgc 103  Q
    |||||||||| |||| |||||||||||||| |||||||||||    
T  14430734 ttctgtgcttgtgcccctggatatccataacccggttgttgc 14430775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University