View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10918_low_18 (Length: 220)

Name: NF10918_low_18
Description: NF10918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10918_low_18
NF10918_low_18
[»] chr2 (2 HSPs)
chr2 (13-133)||(5773921-5774041)
chr2 (132-199)||(5773708-5773775)


Alignment Details
Target: chr2 (Bit Score: 117; Significance: 9e-60; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 13 - 133
Target Start/End: Complemental strand, 5774041 - 5773921
Alignment:
Q  13 caaaggcacaacttttagattctcttggaactaacataaatagtacaaattcaatcacccttcacaatttatttttatatcaaaactaagtttatttttc 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  5774041 caaaggcacaacttttagattctcttggaactaacataaatagtacaaattcaatcacccttcacaatttatttttatatcaaaactaagtttatttttc 5773942  T
Q  113 aaagtcgatgaccacaactta 133  Q
    | |||||||||||||||||||    
T  5773941 acagtcgatgaccacaactta 5773921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 132 - 199
Target Start/End: Complemental strand, 5773775 - 5773708
Alignment:
Q  132 taggagtctaccaaattaatttagaatatcattttttgtttgttttacatacttagttagtgaagaaa 199  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  5773775 taggagtctaccaaattaatttagaatatcattttttgtttgttttacatacttagttagtgaagaaa 5773708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University