View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10916_high_42 (Length: 223)

Name: NF10916_high_42
Description: NF10916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10916_high_42
NF10916_high_42
[»] chr6 (1 HSPs)
chr6 (1-203)||(15702322-15702524)


Alignment Details
Target: chr6 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 15702322 - 15702524
Alignment:
Q  1 tgcatttatttagatttgaagaggcttgggttaaggatgatagatgtgaagatttaattaaagaagcctggcgcagaacaccaaatcaatgcacagagaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
T  15702322 tgcatttatttagatttgaagaggcttgggttaaggatgatagatgtgaggatttaattaaagaagcctggcgcagaacaccaaatcaatgcacagagaa 15702421  T
Q  101 gctgcaggctgttcagacaattgatgagacttttaaggaatatagaacaggggctgttagcaaagaaataaagagaattgaagagctgctcaaagacacc 200  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||| |||||||||    
T  15702422 gctgcagactgttcagacaattgatgagacttttaaggaatatagaacatgggctgttagcaaagaaataaagagagttgaagagctgcttaaagacacc 15702521  T
Q  201 aat 203  Q
    |||    
T  15702522 aat 15702524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University