View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10910_high_14 (Length: 217)

Name: NF10910_high_14
Description: NF10910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10910_high_14
NF10910_high_14
[»] chr1 (1 HSPs)
chr1 (50-201)||(27863119-27863270)


Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 50 - 201
Target Start/End: Original strand, 27863119 - 27863270
Alignment:
Q  50 tggacggtggagatgcggcgaaggtggaggttaataaaatggagtatcagtatccgatacaagctccgatgtattattatgaaggtcaaagtagtaatta 149  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  27863119 tggacggtggagatgcggcgaaggtggaggttaataaaatggagtatcagtatccgatacaagctccgatgtattattatgaaggtcaaagtagtaatta 27863218  T
Q  150 tgctggtatggatcaatttcatcatcaatctggttatggtggtggttatgat 201  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  27863219 tgctggtatggatcaatttcatcatcaatctggttatggtggtggttatgat 27863270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University