View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10905_low_15 (Length: 258)

Name: NF10905_low_15
Description: NF10905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10905_low_15
NF10905_low_15
[»] chr5 (1 HSPs)
chr5 (5-222)||(40546329-40546546)


Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 5 - 222
Target Start/End: Complemental strand, 40546546 - 40546329
Alignment:
Q  5 gagaagcagagaagaaaaaactcgagtgaaaatactaaagggagataaaatagcgacaacgggttaaaataggcttgaatagggttggataagaatatgc 104  Q
    |||| |||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40546546 gagatgcagggaagaaaaaacttgagtgaaaatactaaagggagataaaatagcgacaacgggttaaaataggcttgaatagggttggataagaatatgc 40546447  T
Q  105 atctgctagtaaggaagcagataagttacaaccaacaaagtcacaaaaattgcttttaagacaaatataagttactgccaaccaagttattgtgaagaat 204  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
T  40546446 atctgctagtaaggaagcagataagttacaaccaacaaagtcacaaaaattgcttttaagacaaatataagttactgccaaccaagttattgtgcagaat 40546347  T
Q  205 aacagtttgagccggtgc 222  Q
    ||||||||||||||||||    
T  40546346 aacagtttgagccggtgc 40546329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University