View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10893_low_13 (Length: 241)

Name: NF10893_low_13
Description: NF10893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10893_low_13
NF10893_low_13
[»] chr6 (4 HSPs)
chr6 (1-146)||(4076961-4077106)
chr6 (1-89)||(4178786-4178874)
chr6 (166-226)||(4077182-4077242)
chr6 (88-123)||(4178720-4178755)


Alignment Details
Target: chr6 (Bit Score: 134; Significance: 7e-70; HSPs: 4)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 1 - 146
Target Start/End: Original strand, 4076961 - 4077106
Alignment:
Q  1 agaactacattaacggcaaacaaaacaatcacacatgtatgttttcttgctactatgctcaagattggaaaattcgaggtatggtagttttttggtgaaa 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||    
T  4076961 agaactacattaacggcaaacaaaacaatcacacatgtatgttttcttgctactatgctcaagattggagcattcgaggtatggtagttttttggtgaaa 4077060  T
Q  101 ttttttctcaagatattgtgtttgttacaaagtatataggaattta 146  Q
    |||||||||||| |||||||||||||||||||||||||||||||||    
T  4077061 ttttttctcaagctattgtgtttgttacaaagtatataggaattta 4077106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 4178874 - 4178786
Alignment:
Q  1 agaactacattaacggcaaacaaaacaatcacacatgtatgttttcttgctactatgctcaagattggaaaattcgaggtatggtagtt 89  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||| |||||||||||| |||||    
T  4178874 agaactacattaacggcaaacaaaacaatcacacatgtatgttttctggctactttgctcaagattggaagattcgaggtatgatagtt 4178786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 166 - 226
Target Start/End: Original strand, 4077182 - 4077242
Alignment:
Q  166 cttcttctttcaagttttctctttaaaagagaaatagtctaggataagagatggtatatgt 226  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4077182 cttcttctttcaagttttctctttaaaagagaaatagtctaggataagagatggtatatgt 4077242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 88 - 123
Target Start/End: Complemental strand, 4178755 - 4178720
Alignment:
Q  88 ttttttggtgaaattttttctcaagatattgtgttt 123  Q
    |||||||||||||||||||||||||||||| |||||    
T  4178755 ttttttggtgaaattttttctcaagatattttgttt 4178720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University