View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10891_low_26 (Length: 213)

Name: NF10891_low_26
Description: NF10891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10891_low_26
NF10891_low_26
[»] chr5 (1 HSPs)
chr5 (19-195)||(8908164-8908340)


Alignment Details
Target: chr5 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 19 - 195
Target Start/End: Complemental strand, 8908340 - 8908164
Alignment:
Q  19 ggccgttattggtcatcatacctctctcctcttggaaagccttctcagccagtgtaagtattgtgacattaccatactaataactgtctaaaactctaaa 118  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
T  8908340 ggccgttattggtcatcatacctctctcctcttggaaagccttctcagccagtgtaagtattgtgacattaccatagtaataactgtctaaaactctaaa 8908241  T
Q  119 ttacatgcatgcagtcaagacatgtatatggttagtgatagtagttgaagctaaaatcttgtttccatgtcttgttt 195  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
T  8908240 ttacatgcatgcagtcaagacatgtatatggttagtgatagtagttgaagctaaaatcttgtttccatgttttgttt 8908164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University