View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10887_low_5 (Length: 216)

Name: NF10887_low_5
Description: NF10887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10887_low_5
NF10887_low_5
[»] chr4 (1 HSPs)
chr4 (64-205)||(158164-158305)


Alignment Details
Target: chr4 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 64 - 205
Target Start/End: Complemental strand, 158305 - 158164
Alignment:
Q  64 tccactttattattactcaccaactccttgattttattccttttatttcttcctcccaaccttctaacattgaaggttgtaataatcattgattgcaatt 163  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  158305 tccactttattattactcaccaactccttgattttattccttttatttcttcctcccaaccttctaacattgaaggttgtaataatcattgattgcaatt 158206  T
Q  164 tagtctctcccttgctaccttcaatcctacatcaccttcttc 205  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  158205 tagtctctcccttgctaccttcaatcctacatcaccttcttc 158164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University