View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10882_low_4 (Length: 247)
Name: NF10882_low_4
Description: NF10882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10882_low_4 |
 |  |
|
| [»] scaffold0026 (3 HSPs) |
 |  |  |
|
| [»] scaffold0056 (5 HSPs) |
 |  |  |
|
| [»] scaffold0024 (3 HSPs) |
 |  |  |
|
| [»] scaffold0160 (3 HSPs) |
 |  |  |
|
| [»] scaffold0005 (7 HSPs) |
 |  |  |
|
| [»] scaffold0001 (2 HSPs) |
 |  |  |
|
| [»] scaffold0326 (4 HSPs) |
 |  |  |
|
| [»] scaffold0119 (2 HSPs) |
 |  |  |
|
| [»] scaffold0085 (2 HSPs) |
 |  |  |
|
| [»] scaffold0811 (2 HSPs) |
 |  |  |
|
| [»] scaffold0370 (1 HSPs) |
 |  |  |
|
| [»] scaffold0179 (1 HSPs) |
 |  |  |
|
| [»] scaffold0684 (2 HSPs) |
 |  |  |
|
| [»] scaffold0003 (2 HSPs) |
 |  |  |
|
| [»] scaffold0210 (2 HSPs) |
 |  |  |
|
| [»] scaffold0166 (1 HSPs) |
 |  |  |
|
| [»] scaffold1001 (1 HSPs) |
 |  |  |
|
| [»] scaffold0535 (2 HSPs) |
 |  |  |
|
| [»] scaffold0337 (1 HSPs) |
 |  |  |
|
| [»] scaffold0065 (2 HSPs) |
 |  |  |
|
| [»] scaffold0051 (2 HSPs) |
 |  |  |
|
| [»] scaffold0078 (2 HSPs) |
 |  |  |
|
| [»] scaffold0016 (2 HSPs) |
 |  |  |
|
| [»] scaffold0007 (3 HSPs) |
 |  |  |
|
| [»] scaffold0712 (1 HSPs) |
 |  |  |
|
| [»] scaffold0709 (1 HSPs) |
 |  |  |
|
| [»] scaffold0123 (1 HSPs) |
 |  |  |
|
| [»] scaffold0060 (2 HSPs) |
 |  |  |
|
| [»] scaffold0373 (1 HSPs) |
 |  |  |
|
| [»] scaffold0021 (3 HSPs) |
 |  |  |
|
| [»] scaffold0002 (5 HSPs) |
 |  |  |
|
| [»] scaffold0159 (1 HSPs) |
 |  |  |
|
| [»] scaffold0176 (3 HSPs) |
 |  |  |
|
| [»] scaffold0347 (2 HSPs) |
 |  |  |
|
| [»] scaffold0339 (1 HSPs) |
 |  |  |
|
| [»] scaffold0105 (2 HSPs) |
 |  |  |
|
| [»] scaffold0578 (1 HSPs) |
 |  |  |
|
| [»] scaffold0011 (3 HSPs) |
 |  |  |
|
| [»] scaffold0472 (1 HSPs) |
 |  |  |
|
| [»] scaffold0204 (1 HSPs) |
 |  |  |
|
| [»] scaffold0106 (2 HSPs) |
 |  |  |
|
| [»] scaffold0008 (2 HSPs) |
 |  |  |
|
| [»] scaffold0562 (1 HSPs) |
 |  |  |
|
| [»] scaffold0517 (1 HSPs) |
 |  |  |
|
| [»] scaffold0009 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 6e-98; HSPs: 265)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 35470403 - 35470168
Alignment:
| Q |
1 |
gatcttgtgtggggtggaagggaagggagaagaacttgccacaccaatacaccatctcatagaataaattttgccagcctaaaacaaatggtgaccttga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35470403 |
gatcttgtgtggggtggaagggaagggagaagaacttgccacaccaatacaccatcccatagaataaattttgccagcctaaaacaaatggtgaccttga |
35470304 |
T |
 |
| Q |
101 |
ctttcataatttatatgattttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgttttt |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||| |||||||||||||| ||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
35470303 |
ctttcataatttatatcattttaggctaaaatttggttttgatccctgcaaatatgcctcattttggttttagtccctgtaaaaaaaaattattgttttt |
35470204 |
T |
 |
| Q |
201 |
ggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
35470203 |
tgtccctgcaaatatgcctcattttggttttggtcc |
35470168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 123 - 236
Target Start/End: Original strand, 27458398 - 27458511
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
27458398 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaacttgttgtttttggtccctgcaaatatgcctcat |
27458497 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
27458498 |
tttggttttggtcc |
27458511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 122 - 236
Target Start/End: Original strand, 1614557 - 1614671
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctca |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
1614557 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaatatgtctca |
1614656 |
T |
 |
| Q |
222 |
ttttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
1614657 |
ttttggttttggtcc |
1614671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 118 - 236
Target Start/End: Original strand, 23676126 - 23676244
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgc |
217 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
23676126 |
attttaggttaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaatatgt |
23676225 |
T |
 |
| Q |
218 |
ctcattttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
23676226 |
ctcattttggttttggtcc |
23676244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 119 - 236
Target Start/End: Original strand, 23399607 - 23399724
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||| | |
|
|
| T |
23399607 |
ttttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtc |
23399706 |
T |
 |
| Q |
219 |
tcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
23399707 |
tcattttggttttggtcc |
23399724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 123 - 236
Target Start/End: Original strand, 25092159 - 25092272
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| ||||| |
|
|
| T |
25092159 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctcat |
25092258 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
25092259 |
tttggttttggtcc |
25092272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 119 - 236
Target Start/End: Complemental strand, 41054241 - 41054124
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
41054241 |
ttttaggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgtaatttttttttgttgtttttggtccctgcaaatatgcc |
41054142 |
T |
 |
| Q |
219 |
tcattttggttttggtcc |
236 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
41054141 |
tcattttggttttagtcc |
41054124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 120 - 236
Target Start/End: Complemental strand, 3975842 - 3975727
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcct |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| || ||||||||||||||||||||||||||| |
|
|
| T |
3975842 |
tttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt-cctgtaaaaaaaatttgttgtttttggtccctgcaaatatgcct |
3975744 |
T |
 |
| Q |
220 |
cattttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
3975743 |
cattttggttttggtcc |
3975727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 122 - 236
Target Start/End: Original strand, 9659353 - 9659467
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctca |
221 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
9659353 |
taggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctgcaaaaagaatttgttgtttttggtccctgcaaatatgcctca |
9659452 |
T |
 |
| Q |
222 |
ttttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
9659453 |
ttttggttttggtcc |
9659467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 122 - 236
Target Start/End: Original strand, 29198301 - 29198415
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctca |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
29198301 |
taggctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaatatgtctca |
29198400 |
T |
 |
| Q |
222 |
ttttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
29198401 |
ttttggttttggtcc |
29198415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 123 - 236
Target Start/End: Complemental strand, 25988750 - 25988637
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||| ||||| |
|
|
| T |
25988750 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaacaaaaatttgttgtttttggtccctgcaaatatgtctcat |
25988651 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
25988650 |
tttggttttggtcc |
25988637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 123 - 236
Target Start/End: Original strand, 35837923 - 35838036
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| || |||||||||||||||| ||||||| ||||| |
|
|
| T |
35837923 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccttgtaaaaaaaatttgttgtttttggtccctgtaaatatgtctcat |
35838022 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
35838023 |
tttggttttggtcc |
35838036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 122 - 232
Target Start/End: Complemental strand, 8144660 - 8144550
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctca |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
8144660 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctca |
8144561 |
T |
 |
| Q |
222 |
ttttggttttg |
232 |
Q |
| |
|
||||||||||| |
|
|
| T |
8144560 |
ttttggttttg |
8144550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 123 - 236
Target Start/End: Original strand, 16940761 - 16940874
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |||| |||||||||||||||||| || ||||||||||||| |||||||||||||||| |
|
|
| T |
16940761 |
aggctaacatatggttttggtccctgcaaatatgcctcggtttggttttagtccctgtaaaaaacaattgttgtttttggtccttgcaaatatgcctcat |
16940860 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
16940861 |
tttggttttggtcc |
16940874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 123 - 236
Target Start/End: Original strand, 26877677 - 26877790
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| ||||| |
|
|
| T |
26877677 |
aggctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaatatgtctcat |
26877776 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
26877777 |
tttggttttggtcc |
26877790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 123 - 236
Target Start/End: Complemental strand, 39439030 - 39438917
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||| || |||||||||||||||||||||||| || || |
|
|
| T |
39439030 |
aggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtcttat |
39438931 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
39438930 |
tttggttttggtcc |
39438917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 123 - 236
Target Start/End: Original strand, 44568325 - 44568438
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||| ||||| |
|
|
| T |
44568325 |
aggctaaaatatggttttggtccctgcaaatataactcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctcat |
44568424 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
44568425 |
tttggttttggtcc |
44568438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 123 - 236
Target Start/End: Original strand, 48852443 - 48852556
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| |||||||||| ||| || |||||||||||||||||||||||||||||| |
|
|
| T |
48852443 |
aggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccttgtaaattttttttgttgtttttggtccctgcaaatatgcctcat |
48852542 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||| ||||||||| |
|
|
| T |
48852543 |
tttgattttggtcc |
48852556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 123 - 236
Target Start/End: Original strand, 5233807 - 5233920
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||| || |||||||||||||||||||||||| | ||| |
|
|
| T |
5233807 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaatatgtcccat |
5233906 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
5233907 |
tttggttttggtcc |
5233920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 123 - 236
Target Start/End: Original strand, 30223460 - 30223573
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || || ||||||||||||||||||||| |||| |
|
|
| T |
30223460 |
aggctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtccctgcaaaaaaaatttgttatttttggtccctgcaaatatgtttcat |
30223559 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
30223560 |
tttggttttggtcc |
30223573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 123 - 236
Target Start/End: Original strand, 39520397 - 39520510
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||||||||||||||||||||||| || ||||||||||||||| ||||||| ||||| |
|
|
| T |
39520397 |
aggctaaaatatggttttggtccatccaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctccaaatatatctcat |
39520496 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
39520497 |
tttggttttggtcc |
39520510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 118 - 179
Target Start/End: Original strand, 25988379 - 25988440
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25988379 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
25988440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 119 - 180
Target Start/End: Complemental strand, 35838342 - 35838281
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35838342 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
35838281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 137 - 236
Target Start/End: Complemental strand, 41054163 - 41054064
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41054163 |
ttttggtccctgcaaatatgcctcattttggttttagtccctgtaatttttttttgttgtttttggtccctgcaaatatgcctcattttggttttggtcc |
41054064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 125 - 235
Target Start/End: Complemental strand, 37527421 - 37527311
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattt |
224 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| || ||||||| |||||||||||||||| ||||||| |
|
|
| T |
37527421 |
gctaaaatatggttttggtccctccaaatatgtcttgttttggttttagtccctgtaatttttattttttgttttaggtccctgcaaatatgtctcattt |
37527322 |
T |
 |
| Q |
225 |
tggttttggtc |
235 |
Q |
| |
|
|| |||||||| |
|
|
| T |
37527321 |
tgattttggtc |
37527311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 127 - 236
Target Start/End: Original strand, 11766920 - 11767029
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattttg |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| |||||| | || ||||||||||||| | |||||||||||||||||| |
|
|
| T |
11766920 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttcgtccctataaaaatattttgttgtttttggtccttccaaatatgcctcattttg |
11767019 |
T |
 |
| Q |
227 |
gttttggtcc |
236 |
Q |
| |
|
|||||||||| |
|
|
| T |
11767020 |
gttttggtcc |
11767029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 127 - 236
Target Start/End: Complemental strand, 31503780 - 31503671
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattttg |
226 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| |||||||| |||| || |||||||||||||||||||||||| |||||||| |
|
|
| T |
31503780 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtctctgtaaaagaaatttgttgtttttggtccctgcaaatatgtctcatttta |
31503681 |
T |
 |
| Q |
227 |
gttttggtcc |
236 |
Q |
| |
|
|||||||||| |
|
|
| T |
31503680 |
gttttggtcc |
31503671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 119 - 180
Target Start/End: Original strand, 39832901 - 39832962
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39832901 |
ttttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
39832962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 119 - 176
Target Start/End: Original strand, 46759653 - 46759710
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46759653 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
46759710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 123 - 179
Target Start/End: Original strand, 8144294 - 8144350
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8144294 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
8144350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 23399977 - 23399921
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23399977 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
23399921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 124 - 236
Target Start/End: Complemental strand, 46829312 - 46829198
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt--nnnnnnnnnttattgtttttggtccctgcaaatatgcctca |
221 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
46829312 |
ggctaaaatatggttttgatccctgcaaatatgtctcattttggttttagtccctgtaatattttttgttattgtttttggttcctgcaaatatgccttg |
46829213 |
T |
 |
| Q |
222 |
ttttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
46829212 |
ttttggttttggtcc |
46829198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 118 - 212
Target Start/End: Complemental strand, 16853595 - 16853501
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
16853595 |
atttttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaataaaatttgttgtttttggtccctgcaaa |
16853501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 123 - 212
Target Start/End: Complemental strand, 1614905 - 1614816
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
1614905 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
1614816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 123 - 236
Target Start/End: Complemental strand, 2945846 - 2945733
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||| ||||||||||||||||||||||| || ||||||||||||||| ||||||| ||| | |
|
|
| T |
2945846 |
aggctaaaatatgtttttggtccctacaaatatgcctcgttttggttttagtccctgtaattttttgtttttgtttttggtccctaaaaatatgtctcgt |
2945747 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
2945746 |
tttggttttggtcc |
2945733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 123 - 212
Target Start/End: Original strand, 3975548 - 3975637
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
3975548 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
3975637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 123 - 212
Target Start/End: Complemental strand, 5234205 - 5234116
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
5234205 |
aggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
5234116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 119 - 212
Target Start/End: Original strand, 5354763 - 5354856
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
5354763 |
ttttaggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
5354856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 122 - 236
Target Start/End: Complemental strand, 5355119 - 5355006
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctca |
221 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||| |||||||||||||||||| ||| || ||||||||||||||||||||||||| ||| |
|
|
| T |
5355119 |
taggttaaagtatggttttggtccctgcaaatatgcctcgttttggttttagtcattgt-aaaaaaatttgttgtttttggtccctgcaaatatgcttca |
5355021 |
T |
 |
| Q |
222 |
ttttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
5355020 |
ttttggttttggtcc |
5355006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 123 - 212
Target Start/End: Complemental strand, 9659690 - 9659601
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
9659690 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
9659601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 118 - 180
Target Start/End: Complemental strand, 35104301 - 35104239
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35104301 |
attttaggctcaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
35104239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 123 - 212
Target Start/End: Original strand, 46828943 - 46829032
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
46828943 |
aggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctgtaatttttttttgttgtttttggtccctgcaaa |
46829032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 122 - 179
Target Start/End: Complemental strand, 23676454 - 23676397
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
23676454 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
23676397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 122 - 179
Target Start/End: Complemental strand, 26878073 - 26878016
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26878073 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
26878016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 122 - 179
Target Start/End: Complemental strand, 29198664 - 29198607
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29198664 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29198607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 44344790 - 44344733
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44344790 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
44344733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 45228919 - 45228862
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45228919 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
45228862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 122 - 179
Target Start/End: Complemental strand, 48192490 - 48192433
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
48192490 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
48192433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 124 - 180
Target Start/End: Complemental strand, 19561450 - 19561394
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19561450 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
19561394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 124 - 180
Target Start/End: Complemental strand, 35210515 - 35210459
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35210515 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
35210459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 44568691 - 44568635
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44568691 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
44568635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 124 - 180
Target Start/End: Complemental strand, 46759942 - 46759886
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46759942 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtccctgt |
46759886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 133 - 235
Target Start/End: Complemental strand, 1271590 - 1271488
Alignment:
| Q |
133 |
atggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattttggttttg |
232 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| || |||||||| ||||||||||||||| ||| |||| |||||| |
|
|
| T |
1271590 |
atggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaacttttttgttgtttttagtccctgcaaatatgtctcgttttagttttg |
1271491 |
T |
 |
| Q |
233 |
gtc |
235 |
Q |
| |
|
||| |
|
|
| T |
1271490 |
gtc |
1271488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 127 - 237
Target Start/End: Original strand, 34877777 - 34877887
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattttg |
226 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||| | || |||||||| ||||| ||||||| |||| ||||| |
|
|
| T |
34877777 |
taaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccctttaattttttgtttttgtttttagtcccaacaaatatacctcgttttg |
34877876 |
T |
 |
| Q |
227 |
gttttggtcct |
237 |
Q |
| |
|
||||||||||| |
|
|
| T |
34877877 |
gttttggtcct |
34877887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 121 - 236
Target Start/End: Original strand, 35665874 - 35665987
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctc |
220 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| || ||||||||||||| |||||||||| ||| |
|
|
| T |
35665874 |
ttaggctaaaatatggttttaatccctacaaatatgcctcgttttggttttagtccctgt--agttttttttttgtttttggtccttgcaaatatgtctc |
35665971 |
T |
 |
| Q |
221 |
attttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
35665972 |
gttttggttttggtcc |
35665987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 127 - 234
Target Start/End: Original strand, 44841359 - 44841465
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattttg |
226 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||| ||||||||||||| || |||||||||||||||||||||||| ||| ||||| |
|
|
| T |
44841359 |
taaaatatggttttgatccctgcaaatatgcctcgttttgattttagtccctgt-aattttttttgttgtttttggtccctgcaaatatgtctcgttttg |
44841457 |
T |
 |
| Q |
227 |
gttttggt |
234 |
Q |
| |
|
|||||||| |
|
|
| T |
44841458 |
gttttggt |
44841465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 122 - 180
Target Start/End: Complemental strand, 17999723 - 17999665
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17999723 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
17999665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 118 - 179
Target Start/End: Original strand, 1006829 - 1006890
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1006829 |
atttttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
1006890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 119 - 180
Target Start/End: Complemental strand, 11767280 - 11767219
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
11767280 |
ttttaggctaaaatatggttttggtccctgcaaatatgcttcattttggttttagtccctgt |
11767219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 12894403 - 12894346
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12894403 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
12894346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 176
Target Start/End: Original strand, 14543709 - 14543762
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
14543709 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
14543762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 19757747 - 19757804
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19757747 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
19757804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 28911907 - 28911850
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28911907 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
28911850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 44958507 - 44958450
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
44958507 |
aggctaaaatatgattttggtccctacaaatatgtctcgttttggttttagtccctgt |
44958450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 127 - 215
Target Start/End: Original strand, 48192260 - 48192348
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
48192260 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaatat |
48192348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 124 - 180
Target Start/End: Original strand, 1974009 - 1974065
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1974009 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgt |
1974065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 123 - 179
Target Start/End: Original strand, 6108333 - 6108389
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6108333 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
6108389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 124 - 176
Target Start/End: Original strand, 13769774 - 13769826
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
13769774 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
13769826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 120 - 180
Target Start/End: Original strand, 17854145 - 17854205
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
17854145 |
tttagactaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccctgt |
17854205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 120 - 180
Target Start/End: Original strand, 20388270 - 20388330
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
20388270 |
tttaggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgt |
20388330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 25092549 - 25092493
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
25092549 |
aggctaaaatatggttttggtccctgcaaatatgcctctttttggttttagtccctg |
25092493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 124 - 180
Target Start/End: Complemental strand, 25547490 - 25547434
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
25547490 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt |
25547434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 123 - 179
Target Start/End: Original strand, 35104077 - 35104133
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35104077 |
aggctaaaatataattttggtccctgcaaatatgtctcgttttggttttagtccctg |
35104133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 128 - 180
Target Start/End: Original strand, 37372441 - 37372493
Alignment:
| Q |
128 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37372441 |
aaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
37372493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 44509055 - 44508999
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44509055 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
44508999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 121 - 180
Target Start/End: Original strand, 23816667 - 23816726
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
23816667 |
ttaggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtctctgt |
23816726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 124 - 179
Target Start/End: Original strand, 27037593 - 27037648
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
27037593 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctg |
27037648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 122 - 212
Target Start/End: Original strand, 28262711 - 28262801
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||||||||| ||||||| || |||||||||||||||||||| |
|
|
| T |
28262711 |
taggctaaaatatggttttggtccctgcaaatatgcctcattttggttttaatccctgtaaaaaaaagttgttgtttttggtccctgcaaa |
28262801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 121 - 180
Target Start/End: Complemental strand, 39719645 - 39719586
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
39719645 |
ttaggctaaaatatggttttagtccctgcaaatatggctcgttttagttttagtccctgt |
39719586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 124 - 179
Target Start/End: Original strand, 44508720 - 44508775
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44508720 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
44508775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 122 - 180
Target Start/End: Original strand, 3807862 - 3807920
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3807862 |
taggctaaaatatagttttggttcctgcaaatatgtctcgttttggttttagttcctgt |
3807920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 122 - 180
Target Start/End: Complemental strand, 6892262 - 6892204
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| ||||||| |||||||||||| |
|
|
| T |
6892262 |
taggctaaaatatggttttggtccctgcaaaaatgtcttgttttgggtttagtccctgt |
6892204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 122 - 180
Target Start/End: Complemental strand, 12932785 - 12932727
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
12932785 |
taggctaaaatatgtttttggtccctgcaaatatgcctcgttttgattttagtccctgt |
12932727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 122 - 176
Target Start/End: Original strand, 19783813 - 19783867
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
19783813 |
taggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagtcc |
19783867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 124 - 178
Target Start/End: Complemental strand, 24717532 - 24717478
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
24717532 |
ggctaaaatatggttttggtccctaccaatatgtctcgttttggttttagtccct |
24717478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 122 - 180
Target Start/End: Original strand, 28911575 - 28911633
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
28911575 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtccctgt |
28911633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 123 - 212
Target Start/End: Complemental strand, 30223796 - 30223707
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||||||| ||| || |||||||||||||||||||| |
|
|
| T |
30223796 |
aggctaaaatatggttttggtccatgcaaatatgcctcgttttggttttagtccttgtaaattttttttgttgtttttggtccctgcaaa |
30223707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 121 - 175
Target Start/End: Complemental strand, 30709647 - 30709593
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
175 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
30709647 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtc |
30709593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 121 - 175
Target Start/End: Original strand, 39438738 - 39438792
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
175 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
39438738 |
ttaggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtc |
39438792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 127 - 212
Target Start/End: Complemental strand, 39520727 - 39520642
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||||||| || |||||||||||||||||||| |
|
|
| T |
39520727 |
taaaatatggttttggtccttgcaaatatgtctcgttttgattttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
39520642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 123 - 212
Target Start/End: Original strand, 41053841 - 41053930
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| ||||| ||||||||||||| || |||||||||||||||||||| |
|
|
| T |
41053841 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttgattttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
41053930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 124 - 178
Target Start/End: Complemental strand, 44403249 - 44403195
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
44403249 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccct |
44403195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 124 - 174
Target Start/End: Complemental strand, 48359075 - 48359025
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
174 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
48359075 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
48359025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 123 - 212
Target Start/End: Complemental strand, 48854071 - 48853982
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
48854071 |
aggctaaaatatgattttgatccctgcaaatatgtttcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
48853982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 6509207 - 6509264
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
6509207 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttcgttttagtccctgt |
6509264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 6509471 - 6509414
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
6509471 |
aggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgt |
6509414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 119 - 176
Target Start/End: Original strand, 6589016 - 6589073
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
6589016 |
tttttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtcc |
6589073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 8555800 - 8555743
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
8555800 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctgt |
8555743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 127 - 180
Target Start/End: Complemental strand, 16941049 - 16940996
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
16941049 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgt |
16940996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 172
Target Start/End: Complemental strand, 34878126 - 34878077
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
172 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34878126 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
34878077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 122 - 179
Target Start/End: Complemental strand, 35015222 - 35015165
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
35015222 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
35015165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 119 - 180
Target Start/End: Original strand, 35210177 - 35210238
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| ||||| |||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
35210177 |
ttttaggctaaaatatgattttgatcccggcaaatatgactcgttttggttttagtccctgt |
35210238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 124 - 212
Target Start/End: Original strand, 35469880 - 35469968
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||| |||| || |||||||||||||||||||| |
|
|
| T |
35469880 |
ggctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtctctgtaaaatttttttgttgtttttggtccctgcaaa |
35469968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 37372905 - 37372848
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
37372905 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtacctgt |
37372848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 119 - 180
Target Start/End: Original strand, 45073309 - 45073370
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| | ||||||||||||||| ||||||| |
|
|
| T |
45073309 |
ttttaggctaaaatatggttttagtccctgcaaataagcctcgttttggttttaatccctgt |
45073370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 45073642 - 45073585
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45073642 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
45073585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 124 - 180
Target Start/End: Original strand, 5308323 - 5308379
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
5308323 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccctgt |
5308379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 128 - 180
Target Start/End: Original strand, 6954862 - 6954914
Alignment:
| Q |
128 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
6954862 |
aaaatatggttttggtccctgcaaatatatctcgttttggttttagtctctgt |
6954914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 124 - 180
Target Start/End: Complemental strand, 10358368 - 10358312
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
10358368 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgt |
10358312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 124 - 180
Target Start/End: Original strand, 17999465 - 17999521
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
17999465 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttcgtccctgt |
17999521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 116 - 176
Target Start/End: Complemental strand, 18022712 - 18022652
Alignment:
| Q |
116 |
tgattttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||| |||||||||||||| |||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
18022712 |
tgattataggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtcc |
18022652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 124 - 180
Target Start/End: Original strand, 28528905 - 28528961
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
28528905 |
ggctaaaatatggttttggttcctgtaaatatgtctcgtttgggttttagtccctgt |
28528961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 118 - 174
Target Start/End: Original strand, 38486472 - 38486528
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
174 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
38486472 |
attttaggctaaaatatgattttggtccctgtaaatatgtctcgttttagttttagt |
38486528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 124 - 180
Target Start/End: Complemental strand, 39833236 - 39833180
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39833236 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctgt |
39833180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 124 - 180
Target Start/End: Complemental strand, 46304384 - 46304328
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
46304384 |
ggctaaaatatagttttagtccctgcaaatatgtttcgttttggttttagtccctgt |
46304328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 125 - 180
Target Start/End: Original strand, 6079810 - 6079865
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
6079810 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgt |
6079865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 124 - 175
Target Start/End: Original strand, 7431951 - 7432002
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
175 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
7431951 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
7432002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 21223749 - 21223694
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
21223749 |
aggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccct |
21223694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 121 - 180
Target Start/End: Original strand, 31310362 - 31310421
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
31310362 |
ttaggctaaaatatgattttagtccctgcaaatatttctcgttttggttttagtctctgt |
31310421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 121 - 180
Target Start/End: Complemental strand, 32189393 - 32189334
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||| ||||||||||||||| ||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32189393 |
ttagactaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgt |
32189334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 125 - 176
Target Start/End: Original strand, 43300613 - 43300664
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
43300613 |
gctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagtcc |
43300664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 126 - 180
Target Start/End: Complemental strand, 6847117 - 6847063
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
6847117 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtctctgt |
6847063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #123
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 122 - 180
Target Start/End: Original strand, 10357999 - 10358057
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||| | || ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10357999 |
taggctaaaatatgatcttagtccctgcaaatatgcctcgttttggttttagtccctgt |
10358057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #124
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 122 - 180
Target Start/End: Complemental strand, 19465982 - 19465925
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
19465982 |
taggctaaaatatggttttag-ccctgcaaatatgtctcgtttcggttttagtccctgt |
19465925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #125
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 124 - 174
Target Start/End: Original strand, 19561154 - 19561204
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
174 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
19561154 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
19561204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #126
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 122 - 180
Target Start/End: Complemental strand, 21554755 - 21554697
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| || |||||| ||||||||||||| |
|
|
| T |
21554755 |
taggctaaaatatggttttagtccctgcaaatatgccttgttttgattttagtccctgt |
21554697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #127
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 127 - 212
Target Start/End: Original strand, 31503423 - 31503508
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||| ||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
31503423 |
taaaatatggttttggcccctgtaaatatgtctctttttggttttagtccctgtaatttttttttgttgtttttggtccctgcaaa |
31503508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #128
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 489073 - 489016
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||| |||| ||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
489073 |
aggctaaaatatgattttagtctctgcaaatatgtctcgttttgattttagtccctgt |
489016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #129
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 1559706 - 1559649
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
1559706 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttaattttagtccctgt |
1559649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #130
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 127 - 176
Target Start/End: Complemental strand, 6589271 - 6589222
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
6589271 |
taaaatatggttttggtccctgcaaatatgccttgttttggttttagtcc |
6589222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #131
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 13770082 - 13770025
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| | ||||||||||||||| ||||| |
|
|
| T |
13770082 |
aggctaaaatatggttttagtccctgcaaatatgccccgttttggttttagttcctgt |
13770025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #132
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 125 - 174
Target Start/End: Original strand, 18022368 - 18022417
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
174 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
18022368 |
gctaaaatatggttttagtccccgcaaatatgtctcgttttggttttagt |
18022417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #133
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 127 - 180
Target Start/End: Original strand, 38186369 - 38186422
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |||||| |||||| |
|
|
| T |
38186369 |
taaaatatggttttggtccctgcaaatatgcctcgttttgattttaggccctgt |
38186422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #134
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 123 - 175
Target Start/End: Complemental strand, 38186762 - 38186709
Alignment:
| Q |
123 |
aggctaaaatatggtttt-ggtccctgcaaatatgtctcgttttggttttagtc |
175 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
38186762 |
aggctaaaatatgatttttggtccctgcaaatatgtctcgttttggttttagtc |
38186709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #135
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 44402959 - 44403016
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| | | ||||||||||||||||||| |
|
|
| T |
44402959 |
aggctaaaatatggttttagtccctgcaaatatgccccattttggttttagtccctgt |
44403016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #136
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 122 - 179
Target Start/End: Original strand, 45228613 - 45228670
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||| |||||||| ||||||||||||| |
|
|
| T |
45228613 |
taggctaaaatatggttttgggccccgcaaatatgcctcgtttttgttttagtccctg |
45228670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #137
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 14739005 - 14738949
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
14739005 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtccctg |
14738949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #138
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 127 - 171
Target Start/End: Complemental strand, 28529206 - 28529162
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggtttt |
171 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
28529206 |
taaaatatggttttggtctctgcaaatatgtctcgttttggtttt |
28529162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #139
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 127 - 179
Target Start/End: Original strand, 30352563 - 30352615
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
30352563 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttcagtccctg |
30352615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #140
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 124 - 180
Target Start/End: Original strand, 31732101 - 31732157
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||| ||||| ||||||| |
|
|
| T |
31732101 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttaatccctgt |
31732157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #141
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 124 - 180
Target Start/End: Original strand, 41364884 - 41364940
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| || || |||||||||||||||||||||||||||||||| |
|
|
| T |
41364884 |
ggctaaaatatggttttaatctctacaaatatgtctcgttttggttttagtccctgt |
41364940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #142
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 124 - 179
Target Start/End: Original strand, 45021494 - 45021550
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgtttt-ggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
45021494 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgggttttagtccctg |
45021550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #143
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 122 - 174
Target Start/End: Complemental strand, 45021858 - 45021806
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
174 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| ||||||||||||| |
|
|
| T |
45021858 |
taggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagt |
45021806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #144
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 193 - 236
Target Start/End: Original strand, 6891963 - 6892006
Alignment:
| Q |
193 |
ttgtttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
6891963 |
ttgtttttggtctctgcaaatatgcctcattttggttttggtcc |
6892006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #145
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 118 - 177
Target Start/End: Original strand, 20355402 - 20355461
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
177 |
Q |
| |
|
|||||||||||||||||| ||||| ||| |||||||||| |||||||||||| ||||||| |
|
|
| T |
20355402 |
attttaggctaaaatatgattttgatccttgcaaatatgactcgttttggttgtagtccc |
20355461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #146
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 193 - 236
Target Start/End: Complemental strand, 27037864 - 27037821
Alignment:
| Q |
193 |
ttgtttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
27037864 |
ttgtttttggtccctgcaaatatgtctcattttggttttggtcc |
27037821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #147
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 124 - 179
Target Start/End: Complemental strand, 30352904 - 30352849
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
30352904 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagtccctg |
30352849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #148
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 120 - 175
Target Start/End: Complemental strand, 38486794 - 38486739
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
175 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||| | |||||||||||||||| |
|
|
| T |
38486794 |
tttaggctaaaatatggttttgatccctgtaaatatgccccgttttggttttagtc |
38486739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #149
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 137 - 175
Target Start/End: Complemental strand, 3808106 - 3808068
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtc |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3808106 |
ttttggtccctgcaaatatgtctcgttttggttttagtc |
3808068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #150
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 124 - 174
Target Start/End: Original strand, 19005598 - 19005648
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
174 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
19005598 |
ggctaaaatatagttttggtccctgtaaatatgtctcgttttgattttagt |
19005648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #151
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 122 - 180
Target Start/End: Original strand, 22539928 - 22539986
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| ||| ||||||||||||| ||||| |
|
|
| T |
22539928 |
taggctaaaatatggttttgatccctccaaatatgcctcattttggttttagttcctgt |
22539986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #152
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 126 - 180
Target Start/End: Complemental strand, 28263069 - 28263015
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| | |||||| ||||||||||||| |
|
|
| T |
28263069 |
ctaaaatatggttttgatccctgcaaatatgtattgttttgattttagtccctgt |
28263015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #153
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 126 - 180
Target Start/End: Original strand, 37952671 - 37952725
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
37952671 |
ctaaaatatggttttagtccctgtaaatatgtcttattttggttttagtccctgt |
37952725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #154
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 126 - 180
Target Start/End: Original strand, 43058752 - 43058806
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
43058752 |
ctaaaatatagttttagtccctgcaaatatgtcttgttttgattttagtccctgt |
43058806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #155
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 122 - 180
Target Start/End: Original strand, 45671212 - 45671270
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||| |||||||||||||| |||| ||||||||||||||||||| |||||||| ||||| |
|
|
| T |
45671212 |
taggttaaaatatggttttagtccatgcaaatatgtctcgttttagttttagttcctgt |
45671270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #156
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 1559342 - 1559399
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||| ||||||||| ||||| ||||||| |
|
|
| T |
1559342 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttaatccctgt |
1559399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #157
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 5308687 - 5308631
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||| |||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5308687 |
aggctaaaatatg-ttttagtccctgcaaatatacctcgttttggttttagtccctgt |
5308631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #158
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 197 - 238
Target Start/End: Original strand, 6589034 - 6589075
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcctt |
238 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
6589034 |
ttttggtccctgcaaatatgcctcgttttggttttggtcctt |
6589075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #159
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 23817035 - 23816978
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||| ||| ||||||||||||||||||| ||||| ||||| |
|
|
| T |
23817035 |
aggctaaaatatggttttagtctctgtaaatatgtctcgttttggtattagttcctgt |
23816978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #160
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 123 - 176
Target Start/End: Original strand, 46304085 - 46304138
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||||| |||| || |||||||||||| ||||||||||||||||||| |
|
|
| T |
46304085 |
aggctaaaatatgattttagttcctgcaaatatgcctcgttttggttttagtcc |
46304138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #161
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 123 - 172
Target Start/End: Complemental strand, 46648716 - 46648667
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
172 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||| ||||||||||||||| |
|
|
| T |
46648716 |
aggctaaaatatggttttagtctctgcaaatatgcctcgttttggtttta |
46648667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #162
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 124 - 176
Target Start/End: Complemental strand, 1007229 - 1007177
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||||||||| |||||| |||||||| ||||||||| ||||||||| |
|
|
| T |
1007229 |
ggctaaaatatggttttagtccctccaaatatgcctcgttttgattttagtcc |
1007177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #163
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 124 - 172
Target Start/End: Complemental strand, 6911247 - 6911199
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
172 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
6911247 |
ggctaaaatatggttttggttcctgcaaatatacctcgttttggtttta |
6911199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #164
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 127 - 175
Target Start/End: Complemental strand, 18891562 - 18891514
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
175 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
18891562 |
taaaatatggttttagtccctgcaaatatgtctcgttttaattttagtc |
18891514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #165
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 137 - 177
Target Start/End: Complemental strand, 19005865 - 19005825
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccc |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
19005865 |
ttttggtccctgcaaatatgtctcgttttggttttggtccc |
19005825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #166
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 124 - 180
Target Start/End: Original strand, 21223405 - 21223461
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
21223405 |
ggctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagtctctgt |
21223461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #167
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 124 - 176
Target Start/End: Original strand, 21554393 - 21554445
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||||||||| |||| ||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
21554393 |
ggctaaaatatgattttagtccctgaaaatatgcctcgttttggttttagtcc |
21554445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #168
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 122 - 174
Target Start/End: Original strand, 25547251 - 25547303
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
174 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
25547251 |
taggttaaaatatggttttaatccctgcaaatatgcctcgttttggttttagt |
25547303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #169
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 127 - 175
Target Start/End: Complemental strand, 37953048 - 37953000
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
175 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||| ||||||||||||||| |
|
|
| T |
37953048 |
taaaatatggttttagtccctgtaaatatgtcttgttttggttttagtc |
37953000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #170
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 124 - 180
Target Start/End: Original strand, 39719353 - 39719409
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| |||||| |||||||| ||| |||||||||||||| |||| |
|
|
| T |
39719353 |
ggctaaaatatggttttagtccctacaaatatgcctcattttggttttagtctctgt |
39719409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #171
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 122 - 178
Target Start/End: Complemental strand, 45671550 - 45671494
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
|||| |||||||||||||| ||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
45671550 |
taggttaaaatatggttttagtcattgcaaatatgtctcgttttagttttagtccct |
45671494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #172
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 16941039 - 16941000
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
16941039 |
ttttggtccctgcaaatatgcctcattttggttttagtcc |
16941000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #173
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 124 - 175
Target Start/End: Complemental strand, 18927091 - 18927040
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
175 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||||||| |||| ||||||||| |
|
|
| T |
18927091 |
ggctaaaatatagttttagtccctgcaaatatgtctcattttagttttagtc |
18927040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #174
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 193 - 236
Target Start/End: Complemental strand, 19005869 - 19005826
Alignment:
| Q |
193 |
ttgtttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
19005869 |
ttgtttttggtccctgcaaatatgtctcgttttggttttggtcc |
19005826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #175
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 123 - 170
Target Start/End: Complemental strand, 31310680 - 31310633
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
170 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
31310680 |
aggctaaaatatggttttagtccctgcaaatatgcatcgttttggttt |
31310633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #176
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 23399685 - 23399727
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
23399685 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
23399727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #177
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 23676205 - 23676247
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
23676205 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
23676247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #178
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 25092233 - 25092275
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
25092233 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
25092275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #179
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 25988676 - 25988634
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
25988676 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
25988634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #180
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 26877751 - 26877793
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
26877751 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
26877793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #181
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 27037860 - 27037818
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
27037860 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
27037818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #182
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 197 - 231
Target Start/End: Original strand, 28262726 - 28262760
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggtttt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
28262726 |
ttttggtccctgcaaatatgcctcattttggtttt |
28262760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #183
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 29198376 - 29198418
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
29198376 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
29198418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #184
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 123 - 173
Target Start/End: Complemental strand, 31732452 - 31732402
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttag |
173 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| ||||||||| |||||| |
|
|
| T |
31732452 |
aggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttag |
31732402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #185
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 35665948 - 35665990
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
35665948 |
ttttggtccttgcaaatatgtctcgttttggttttggtccctg |
35665990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #186
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 44568399 - 44568441
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
44568399 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
44568441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #187
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 127 - 165
Target Start/End: Complemental strand, 44841711 - 44841673
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgtttt |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
44841711 |
taaaatatggttttggtccctgcaaatatgactcgtttt |
44841673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #188
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 137 - 178
Target Start/End: Original strand, 1614632 - 1614673
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
1614632 |
ttttggtccctgcaaatatgtctcattttggttttggtccct |
1614673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #189
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 123 - 176
Target Start/End: Original strand, 6911081 - 6911134
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||||| ||||||||| | ||||||||||||||||| ||||||||| |
|
|
| T |
6911081 |
aggctaaaatatgattttggtccttataaatatgtctcgttttgattttagtcc |
6911134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #190
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 119 - 179
Target Start/End: Original strand, 24717222 - 24717283
Alignment:
| Q |
119 |
ttttaggctaaaatatggtttt-ggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||| ||||||||||||||||| |||||||| ||||||||||| ||||| |||| ||||||| |
|
|
| T |
24717222 |
tttttggctaaaatatggtttttggtccctgtaaatatgtctcattttgattttggtccctg |
24717283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #191
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 127 - 176
Target Start/End: Original strand, 30709328 - 30709377
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||| |||| |||||| |||||||| ||||||||||||||||||| |
|
|
| T |
30709328 |
taaaatatgattttagtccctacaaatatgcctcgttttggttttagtcc |
30709377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #192
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 119 - 172
Target Start/End: Original strand, 32189071 - 32189124
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
172 |
Q |
| |
|
|||| |||||||||||| |||| ||||||||||||||| |||||||||||||| |
|
|
| T |
32189071 |
tttttggctaaaatatgattttagtccctgcaaatatgcttcgttttggtttta |
32189124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #193
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 123 - 172
Target Start/End: Original strand, 36684534 - 36684583
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
172 |
Q |
| |
|
|||||||||||||| |||| ||| ||||||||| |||||||||||||||| |
|
|
| T |
36684534 |
aggctaaaatatggctttgatccatgcaaatatatctcgttttggtttta |
36684583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #194
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 125 - 174
Target Start/End: Complemental strand, 41365213 - 41365164
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
174 |
Q |
| |
|
|||||||||||||||| || || ||||||||| ||||||||||||||||| |
|
|
| T |
41365213 |
gctaaaatatggttttagttcccgcaaatatgcctcgttttggttttagt |
41365164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #195
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 123 - 172
Target Start/End: Original strand, 44344456 - 44344505
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
172 |
Q |
| |
|
|||||||||||||||||| || || ||||||||||||||||| ||||||| |
|
|
| T |
44344456 |
aggctaaaatatggttttagttcccgcaaatatgtctcgtttcggtttta |
44344505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #196
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 130 - 170
Target Start/End: Original strand, 488720 - 488760
Alignment:
| Q |
130 |
aatatggttttggtccctgcaaatatgtctcgttttggttt |
170 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
488720 |
aatatggttttagtccttgcaaatatgtctcgttttggttt |
488760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #197
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 197 - 237
Target Start/End: Complemental strand, 3975825 - 3975785
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcct |
237 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
3975825 |
ttttggtccctgcaaatatgcctcgttttggttttagtcct |
3975785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #198
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 197 - 237
Target Start/End: Original strand, 14738613 - 14738653
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcct |
237 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
14738613 |
ttttagtccctgcaaatatgcctcattttggttttagtcct |
14738653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #199
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 124 - 180
Target Start/End: Complemental strand, 20388675 - 20388619
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| ||| ||| ||||||| ||||||||| ||||||| ||||| |
|
|
| T |
20388675 |
ggctaaaatatggttttagtcgctgaaaatatgcctcgttttgattttagttcctgt |
20388619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #200
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 123 - 179
Target Start/End: Original strand, 35212067 - 35212123
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| | |||| |||||| ||||||| |
|
|
| T |
35212067 |
aggctaaaatatgtttttggtccctgcaaatatgacgagtttgggttttggtccctg |
35212123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #201
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 124 - 179
Target Start/End: Original strand, 1271238 - 1271293
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||| |||| ||||||| |||||||||||||||| |||||| |||||| |
|
|
| T |
1271238 |
ggctaaaatattgtttcggtccctctaaatatgtctcgttttagttttaatccctg |
1271293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #202
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 1271586 - 1271547
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
1271586 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
1271547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #203
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 1614891 - 1614852
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
1614891 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
1614852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #204
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Original strand, 3975562 - 3975601
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
3975562 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
3975601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #205
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 120 - 155
Target Start/End: Complemental strand, 5611570 - 5611535
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatat |
155 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5611570 |
tttaggctaaaatatgattttggtccctgcaaatat |
5611535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #206
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 138 - 236
Target Start/End: Original strand, 6887174 - 6887272
Alignment:
| Q |
138 |
tttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||||| ||| | ||||||||||||||| |||||||| || ||||||||||||||| |
|
|
| T |
6887174 |
tttggtccttgcaaatatgtcttgttttggttttagtctttgtaatttttttgttttgtttttggtccctacaaatatgtttcgttttggttttggtcc |
6887272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #207
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 8144645 - 8144606
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
8144645 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
8144606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #208
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 9659676 - 9659637
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
9659676 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
9659637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #209
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 11767262 - 11767223
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
11767262 |
ttttggtccctgcaaatatgcttcattttggttttagtcc |
11767223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #210
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Original strand, 14543723 - 14543762
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
14543723 |
ttttggtccctgcaaatatgtctcattttggttttagtcc |
14543762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #211
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 16853576 - 16853537
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
16853576 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
16853537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #212
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 125 - 172
Target Start/End: Original strand, 18311581 - 18311628
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
172 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||||||||||||||| |
|
|
| T |
18311581 |
gctaaaatatggttttagtctctacaaatatgcctcgttttggtttta |
18311628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #213
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 23676439 - 23676400
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
23676439 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
23676400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #214
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 25092535 - 25092496
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
25092535 |
ttttggtccctgcaaatatgcctctttttggttttagtcc |
25092496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #215
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 26878058 - 26878019
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
26878058 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
26878019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #216
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 121 - 152
Target Start/End: Complemental strand, 27037905 - 27037874
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaa |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
27037905 |
ttaggctaaaatatggttttggtccctgcaaa |
27037874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #217
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 29198649 - 29198610
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
29198649 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
29198610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #218
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 35104282 - 35104243
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
35104282 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
35104243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #219
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 123 - 158
Target Start/End: Complemental strand, 36687264 - 36687229
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtc |
158 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36687264 |
aggctaaaatatgattttggtccctgcaaatatgtc |
36687229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #220
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Original strand, 41053855 - 41053894
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
41053855 |
ttttggtccctgcaaatatgcctcattttgattttagtcc |
41053894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #221
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 45228905 - 45228866
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
45228905 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
45228866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #222
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Original strand, 48192270 - 48192309
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
48192270 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
48192309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #223
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 48192475 - 48192436
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
48192475 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
48192436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #224
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 2945772 - 2945730
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
2945772 |
ttttggtccctaaaaatatgtctcgttttggttttggtccctg |
2945730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #225
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 193 - 231
Target Start/End: Complemental strand, 3808110 - 3808072
Alignment:
| Q |
193 |
ttgtttttggtccctgcaaatatgcctcattttggtttt |
231 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
3808110 |
ttgtttttggtccctgcaaatatgtctcgttttggtttt |
3808072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #226
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 146 - 180
Target Start/End: Complemental strand, 3954172 - 3954138
Alignment:
| Q |
146 |
ctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3954172 |
ctgcatatatgtctcgttttggttttagtccctgt |
3954138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #227
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 3975766 - 3975724
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||||| |
|
|
| T |
3975766 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
3975724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #228
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 5233881 - 5233923
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||| ||||||| |
|
|
| T |
5233881 |
ttttggtccctgcaaatatgtcccattttggttttggtccctg |
5233923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #229
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 6887233 - 6887275
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||| ||||||| |
|
|
| T |
6887233 |
ttttggtccctacaaatatgtttcgttttggttttggtccctg |
6887275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #230
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 118 - 172
Target Start/End: Original strand, 8555601 - 8555655
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
172 |
Q |
| |
|
||||||||||||||||| ||||| || ||||||||||| || |||||||||||| |
|
|
| T |
8555601 |
attttaggctaaaatatagttttagtttctgcaaatatgacttgttttggtttta |
8555655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #231
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 9659428 - 9659470
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||||| |
|
|
| T |
9659428 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
9659470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #232
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 142 - 180
Target Start/End: Original strand, 12894059 - 12894097
Alignment:
| Q |
142 |
gtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
12894059 |
gtccctgcaaatatgcctcgttttggttttaatccctgt |
12894097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #233
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 194 - 236
Target Start/End: Complemental strand, 12932773 - 12932731
Alignment:
| Q |
194 |
tgtttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||| |||| |
|
|
| T |
12932773 |
tgtttttggtccctgcaaatatgcctcgttttgattttagtcc |
12932731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #234
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 126 - 180
Target Start/End: Original strand, 18926889 - 18926943
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||| || | | |||||||| ||||||||||||| ||||||||| |
|
|
| T |
18926889 |
ctaaaatatggttttagttcattcaaatatgactcgttttggtttaagtccctgt |
18926943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #235
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 142 - 180
Target Start/End: Complemental strand, 19758041 - 19758003
Alignment:
| Q |
142 |
gtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
19758041 |
gtccctgcaaatatgcctcattttggttttagtccctgt |
19758003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #236
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 236
Target Start/End: Complemental strand, 19758041 - 19758007
Alignment:
| Q |
202 |
gtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
19758041 |
gtccctgcaaatatgcctcattttggttttagtcc |
19758007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #237
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 171
Target Start/End: Original strand, 20355488 - 20355522
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggtttt |
171 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |
|
|
| T |
20355488 |
ttttggtccttgcaaatatgtctcgttttggtttt |
20355522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #238
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 27458472 - 27458514
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||||| |
|
|
| T |
27458472 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
27458514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #239
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 119 - 212
Target Start/End: Complemental strand, 27458722 - 27458631
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
||||| ||||||||||| ||| ||||| |||||||||| |||||||| |||||||||||||| || |||||||||||||||||||| |
|
|
| T |
27458722 |
ttttatgctaaaatatgattt-ggtcc-tgcaaatatgcctcgttttagttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
27458631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #240
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 31503710 - 31503668
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||| ||||||| |
|
|
| T |
31503710 |
ttttggtccctgcaaatatgtctcattttagttttggtccctg |
31503668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #241
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 121 - 155
Target Start/End: Complemental strand, 32197971 - 32197937
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatat |
155 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32197971 |
ttaggctaaaatatgcttttggtccctgcaaatat |
32197937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #242
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 35837997 - 35838039
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||| ||||||| |
|
|
| T |
35837997 |
ttttggtccctgtaaatatgtctcattttggttttggtccctg |
35838039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #243
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 39438956 - 39438914
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
39438956 |
ttttggtccctgcaaatatgtcttattttggttttggtccctg |
39438914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #244
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 122 - 156
Target Start/End: Original strand, 40576764 - 40576798
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatg |
156 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
40576764 |
taggctaaaatatgcttttggtccctgcaaatatg |
40576798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #245
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 41054103 - 41054061
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||||| |
|
|
| T |
41054103 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
41054061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #246
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 197 - 231
Target Start/End: Complemental strand, 45021843 - 45021809
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggtttt |
231 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
45021843 |
ttttagtccctgcaaatatgcctcattttggtttt |
45021809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #247
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 122 - 155
Target Start/End: Original strand, 12933417 - 12933450
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatat |
155 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
12933417 |
taggctaaaatatgcttttggtccctgcaaatat |
12933450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #248
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 127 - 176
Target Start/End: Original strand, 14738603 - 14738652
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||||| |||| ||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
14738603 |
taaaatattattttagtccctgcaaatatgcctcattttggttttagtcc |
14738652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #249
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 197 - 238
Target Start/End: Complemental strand, 18022691 - 18022650
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcctt |
238 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
18022691 |
ttttagtccctgcaaatatgcctcgttttggttttagtcctt |
18022650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #250
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 122 - 155
Target Start/End: Complemental strand, 24197164 - 24197131
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatat |
155 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
24197164 |
taggctaaaatatgcttttggtccctgcaaatat |
24197131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #251
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 195 - 236
Target Start/End: Original strand, 24717239 - 24717280
Alignment:
| Q |
195 |
gtttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||| ||||||||| |
|
|
| T |
24717239 |
gtttttggtccctgtaaatatgtctcattttgattttggtcc |
24717280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #252
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 119 - 156
Target Start/End: Complemental strand, 25046304 - 25046267
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatg |
156 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
25046304 |
ttttaggctaaaatatgattttggtccttgcaaatatg |
25046267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #253
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 137 - 178
Target Start/End: Original strand, 30223534 - 30223575
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
||||||||||||||||||||| || |||||||||| |||||| |
|
|
| T |
30223534 |
ttttggtccctgcaaatatgtttcattttggttttggtccct |
30223575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #254
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 197 - 238
Target Start/End: Complemental strand, 30223782 - 30223741
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcctt |
238 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||| |||||| |
|
|
| T |
30223782 |
ttttggtccatgcaaatatgcctcgttttggttttagtcctt |
30223741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #255
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 197 - 238
Target Start/End: Original strand, 35837937 - 35837978
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcctt |
238 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| |||||| |
|
|
| T |
35837937 |
ttttggtccctgcaaatatgtctcgttttggttttagtcctt |
35837978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #256
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 119 - 156
Target Start/End: Original strand, 36748193 - 36748230
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatg |
156 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
36748193 |
tttttggctaaaatatgtttttggtccctgcaaatatg |
36748230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #257
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 126 - 171
Target Start/End: Complemental strand, 37159906 - 37159861
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttt |
171 |
Q |
| |
|
|||||||||| ||||||| |||||||||||| ||||||||||||| |
|
|
| T |
37159906 |
ctaaaatatgattttggtttctgcaaatatgtttcgttttggtttt |
37159861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #258
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 197 - 238
Target Start/End: Original strand, 46759671 - 46759712
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcctt |
238 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| |||||| |
|
|
| T |
46759671 |
ttttggtccctgcaaatatgtctcgttttggttttagtcctt |
46759712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #259
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 197 - 238
Target Start/End: Original strand, 48852457 - 48852498
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcctt |
238 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||| |||||| |
|
|
| T |
48852457 |
ttttggtccctgcaaatatgcctcgtttttgttttagtcctt |
48852498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #260
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 127 - 175
Target Start/End: Complemental strand, 7432249 - 7432201
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
175 |
Q |
| |
|
|||||||||||||| | |||||||||||| ||||||||| |||||||| |
|
|
| T |
7432249 |
taaaatatggttttaattcctgcaaatatgcctcgttttgattttagtc |
7432201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #261
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 123 - 155
Target Start/End: Original strand, 13418949 - 13418981
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatat |
155 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
13418949 |
aggctaaaatatgtttttggtccctgcaaatat |
13418981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #262
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 123 - 155
Target Start/End: Original strand, 24195606 - 24195638
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatat |
155 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
24195606 |
aggctaaaatatgtttttggtccctgcaaatat |
24195638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #263
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 132 - 176
Target Start/End: Original strand, 24953828 - 24953872
Alignment:
| Q |
132 |
tatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||| ||||||||||||||| | |||||||||||||||| |
|
|
| T |
24953828 |
tatggttttagtccctgcaaatatgcattgttttggttttagtcc |
24953872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #264
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 119 - 155
Target Start/End: Original strand, 31846981 - 31847017
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatat |
155 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
31846981 |
ttttaggttaaaatatgcttttggtccctgcaaatat |
31847017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #265
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 120 - 152
Target Start/End: Original strand, 35014924 - 35014956
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaa |
152 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
35014924 |
tttaggctaaaatatggttttagtccctgcaaa |
35014956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 83; Significance: 2e-39; HSPs: 291)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 123 - 236
Target Start/End: Complemental strand, 25424313 - 25424200
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
25424313 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaatatgcctcat |
25424214 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
25424213 |
tttggttttggtcc |
25424200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 120 - 236
Target Start/End: Complemental strand, 14488191 - 14488075
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcct |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| || ||||||||||||||||||||||||| | |
|
|
| T |
14488191 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaatatgctt |
14488092 |
T |
 |
| Q |
220 |
cattttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
14488091 |
cattttggttttggtcc |
14488075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 123 - 236
Target Start/End: Original strand, 43231087 - 43231200
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| ||||| |
|
|
| T |
43231087 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaaaaaaattgttgtttttggtccctgcaaatatgtctcat |
43231186 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
43231187 |
tttggttttggtcc |
43231200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 116 - 236
Target Start/End: Original strand, 31811917 - 31812035
Alignment:
| Q |
116 |
tgattttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatat |
215 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
31811917 |
tgatttaaggctaaaatatggttttgatccctgcaaatatgtatcgttttggttttagtccctgt--aattttttttttgtttttggtccctgcaaatat |
31812014 |
T |
 |
| Q |
216 |
gcctcattttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
31812015 |
gcctcattttggttttggtcc |
31812035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 122 - 236
Target Start/End: Original strand, 13530377 - 13530491
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctca |
221 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
13530377 |
taggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctgcaaaaagaatttgttgtttttggtccctgcaaatatgcctca |
13530476 |
T |
 |
| Q |
222 |
ttttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
13530477 |
ttttggttttggtcc |
13530491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 118 - 236
Target Start/End: Complemental strand, 26412590 - 26412472
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgc |
217 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
26412590 |
atttttggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgt |
26412491 |
T |
 |
| Q |
218 |
ctcattttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
26412490 |
ctcattttggttttggtcc |
26412472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 119 - 236
Target Start/End: Original strand, 23245226 - 23245343
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcc |
218 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||| | |
|
|
| T |
23245226 |
tttttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtc |
23245325 |
T |
 |
| Q |
219 |
tcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
23245326 |
tcattttggttttggtcc |
23245343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 119 - 236
Target Start/End: Complemental strand, 35464387 - 35464270
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcc |
218 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||| | |
|
|
| T |
35464387 |
tttttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtc |
35464288 |
T |
 |
| Q |
219 |
tcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
35464287 |
tcattttggttttggtcc |
35464270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 127 - 236
Target Start/End: Complemental strand, 54208822 - 54208713
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattttg |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||| || |||||| ||||||||||||||||||||||||||| |
|
|
| T |
54208822 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgtaattttttttttttgtttatggtccctgcaaatatgcctcattttg |
54208723 |
T |
 |
| Q |
227 |
gttttggtcc |
236 |
Q |
| |
|
|||||||||| |
|
|
| T |
54208722 |
gttttggtcc |
54208713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 124 - 236
Target Start/End: Complemental strand, 42848391 - 42848279
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcatt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||| |||||| |
|
|
| T |
42848391 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaaattgttgtttttggtccctgcaaatatgtctcatt |
42848292 |
T |
 |
| Q |
224 |
ttggttttggtcc |
236 |
Q |
| |
|
||||||||||||| |
|
|
| T |
42848291 |
ttggttttggtcc |
42848279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 121 - 236
Target Start/End: Complemental strand, 47023108 - 47022993
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctc |
220 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| || |||||| ||||||||||||||||||||| |
|
|
| T |
47023108 |
ttaggctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtccctgcaaaaaaaatttgttgtttctggtccctgcaaatatgcctc |
47023009 |
T |
 |
| Q |
221 |
attttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
47023008 |
attttggttttggtcc |
47022993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 122 - 236
Target Start/End: Complemental strand, 5797822 - 5797708
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctca |
221 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||||||||||||||||| |||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
5797822 |
taggttaaaatatggttttggtccctacaaatatgtctcgttttggttttaatccctgcaaaaaaaaattgttgtttttggtccctgcaaatatgcctca |
5797723 |
T |
 |
| Q |
222 |
ttttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
5797722 |
ttttggttttggtcc |
5797708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 125 - 236
Target Start/End: Original strand, 36050289 - 36050398
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattt |
224 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||| ||| |
|
|
| T |
36050289 |
gctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtccctgt--aattttgtttttgtttttggtccctgcaaatatgcctcgttt |
36050386 |
T |
 |
| Q |
225 |
tggttttggtcc |
236 |
Q |
| |
|
|||||||||||| |
|
|
| T |
36050387 |
tggttttggtcc |
36050398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 122 - 236
Target Start/End: Original strand, 53915681 - 53915795
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctca |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
53915681 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctca |
53915780 |
T |
 |
| Q |
222 |
ttttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
53915781 |
ttttggttttggtcc |
53915795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 123 - 232
Target Start/End: Complemental strand, 13631600 - 13631491
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||| ||||| |
|
|
| T |
13631600 |
aggctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaatatgtctcat |
13631501 |
T |
 |
| Q |
223 |
tttggttttg |
232 |
Q |
| |
|
|||||||||| |
|
|
| T |
13631500 |
tttggttttg |
13631491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 127 - 236
Target Start/End: Complemental strand, 29499543 - 29499434
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattttg |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||| ||||||||| |
|
|
| T |
29499543 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaattttttgttgtttttggtccctgcaaatatgtctcattttg |
29499444 |
T |
 |
| Q |
227 |
gttttggtcc |
236 |
Q |
| |
|
|||||||||| |
|
|
| T |
29499443 |
gttttggtcc |
29499434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 123 - 236
Target Start/End: Complemental strand, 46115780 - 46115667
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||||||||||||||||| || ||||||||||||||||||||||||||| || |
|
|
| T |
46115780 |
aggctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgccttat |
46115681 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
46115680 |
tttggttttggtcc |
46115667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 123 - 236
Target Start/End: Complemental strand, 46128914 - 46128801
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||||||||||||||||| || ||||||||||||||||||||||||||| || |
|
|
| T |
46128914 |
aggctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgccttat |
46128815 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
46128814 |
tttggttttggtcc |
46128801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 125 - 236
Target Start/End: Complemental strand, 51763201 - 51763090
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattt |
224 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||| ||||||||||||| ||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
51763201 |
gctaaaatatagttttggtccctgcaaatatgcctcattttggttttagttcctgtaaattttttttgttgtttttggtccctgcaaatatgcctcattt |
51763102 |
T |
 |
| Q |
225 |
tggttttggtcc |
236 |
Q |
| |
|
|||||||||||| |
|
|
| T |
51763101 |
tggttttggtcc |
51763090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 122 - 236
Target Start/End: Original strand, 30060767 - 30060881
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctca |
221 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||||| |||||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
30060767 |
taggttaaaatatggttttggtccctgcaaatatgcctcgttttgtttttagtccctgcaatatttttttgttgtttttggtccctgcaaatatgtctca |
30060866 |
T |
 |
| Q |
222 |
ttttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
30060867 |
ttttggttttggtcc |
30060881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 122 - 235
Target Start/End: Complemental strand, 12152495 - 12152382
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctca |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| || ||||||||||| |||||||||||| || |
|
|
| T |
12152495 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttggtccctgtaatttttatttgttgtttttggttcctgcaaatatgtttcg |
12152396 |
T |
 |
| Q |
222 |
ttttggttttggtc |
235 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
12152395 |
ttttggttttggtc |
12152382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 123 - 236
Target Start/End: Original strand, 31560330 - 31560443
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| || |||||||||||||||||||||||| ||||| |
|
|
| T |
31560330 |
aggctaaaatatggttttgatccctgcaaatatgcttcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctcat |
31560429 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
31560430 |
tttggttttggtcc |
31560443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 119 - 212
Target Start/End: Original strand, 35464013 - 35464106
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
35464013 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
35464106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 123 - 236
Target Start/End: Complemental strand, 54903476 - 54903364
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| || |||||||||||||||||||||||| ||| | |
|
|
| T |
54903476 |
aggctaaaatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaattttttgtt-ttgtttttggtccctgcaaatatgtctcgt |
54903378 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
54903377 |
tttggttttggtcc |
54903364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 123 - 231
Target Start/End: Complemental strand, 2322433 - 2322325
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| || |||||||||||||||||||||||| ||| | |
|
|
| T |
2322433 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtgcctgtaaattgtttttgttgtttttggtccctgcaaatatgtctcgt |
2322334 |
T |
 |
| Q |
223 |
tttggtttt |
231 |
Q |
| |
|
||||||||| |
|
|
| T |
2322333 |
tttggtttt |
2322325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 124 - 236
Target Start/End: Original strand, 5827655 - 5827767
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcatt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| || ||||||||| |||||| ||||||| ||| || |
|
|
| T |
5827655 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaaattttttttgttgtttttgatccctgaaaatatgtctcgtt |
5827754 |
T |
 |
| Q |
224 |
ttggttttggtcc |
236 |
Q |
| |
|
||||||||||||| |
|
|
| T |
5827755 |
ttggttttggtcc |
5827767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 120 - 212
Target Start/End: Original strand, 13631224 - 13631316
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
13631224 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
13631316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 125 - 235
Target Start/End: Complemental strand, 6353637 - 6353527
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattt |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || |||| ||| | ||||||||||||||||||||| |
|
|
| T |
6353637 |
gctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccctgtaaattgtttttgttgtctttagcccctgcaaatatgcctcattt |
6353538 |
T |
 |
| Q |
225 |
tggttttggtc |
235 |
Q |
| |
|
||||||||||| |
|
|
| T |
6353537 |
tggttttggtc |
6353527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 122 - 236
Target Start/End: Original strand, 19903259 - 19903373
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctca |
221 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||||||| ||||| ||||||||||||| || ||||||||| |||||||||||||| |||| |
|
|
| T |
19903259 |
taggctaaaatatagttttgatccctgcaaatatgtctcattttgattttagtccctgtaattttttgttgttgtttttgatccctgcaaatatgtctca |
19903358 |
T |
 |
| Q |
222 |
ttttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
19903359 |
ttttggttttggtcc |
19903373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 123 - 212
Target Start/End: Original strand, 25423923 - 25424012
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
25423923 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
25424012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 124 - 236
Target Start/End: Complemental strand, 7642652 - 7642541
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcatt |
223 |
Q |
| |
|
|||||||||||| || ||||| |||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||| |||||| |
|
|
| T |
7642652 |
ggctaaaatatgattatggtctctgcaaatatgtttcgttttggttttagtccctgtaattttttgtt-ttgtttttggtccctgcaaatatgtctcatt |
7642554 |
T |
 |
| Q |
224 |
ttggttttggtcc |
236 |
Q |
| |
|
||||||||||||| |
|
|
| T |
7642553 |
ttggttttggtcc |
7642541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 120 - 236
Target Start/End: Complemental strand, 12791978 - 12791862
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcct |
219 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||| ||||||||||||||||||||||| || || ||||||| |||||||||||||| | |
|
|
| T |
12791978 |
tttaggctaaaatatgatttttgtccctgcaaatatgcctcgttttggttttagtccctgtaacttttttttgttatttttggcccctgcaaatatgcat |
12791879 |
T |
 |
| Q |
220 |
cattttggttttggtcc |
236 |
Q |
| |
|
| ||||||||||||||| |
|
|
| T |
12791878 |
cgttttggttttggtcc |
12791862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 124 - 231
Target Start/End: Original strand, 13073759 - 13073867
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt-nnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||| ||| | |
|
|
| T |
13073759 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaatgattttttgttgtttttggtccctgcaaatatatctcgt |
13073858 |
T |
 |
| Q |
223 |
tttggtttt |
231 |
Q |
| |
|
||||||||| |
|
|
| T |
13073859 |
tttggtttt |
13073867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 122 - 234
Target Start/End: Original strand, 19321568 - 19321680
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctca |
221 |
Q |
| |
|
|||||||||||||| |||||||||||| ||| ||| |||||||||||||||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
19321568 |
taggctaaaatatgattttggtccctgtaaacatgcctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaatatgtctca |
19321667 |
T |
 |
| Q |
222 |
ttttggttttggt |
234 |
Q |
| |
|
||||||||||||| |
|
|
| T |
19321668 |
ttttggttttggt |
19321680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 14791807 - 14791751
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14791807 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
14791751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 122 - 178
Target Start/End: Complemental strand, 29420539 - 29420483
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29420539 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
29420483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 123 - 236
Target Start/End: Complemental strand, 2034856 - 2034742
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt-nnnnnnnnnttattgtttttggtccctgcaaatatgcctca |
221 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||| ||||||||||||||||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
2034856 |
aggctaaaatatggttttagtcccagcaaatatgcctcgttttggttttagtccctgtaattttttttttgttgtttttggtccctgcaaatatgtctca |
2034757 |
T |
 |
| Q |
222 |
ttttggttttggtcc |
236 |
Q |
| |
|
|||||||||| |||| |
|
|
| T |
2034756 |
ttttggttttagtcc |
2034742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 120 - 179
Target Start/End: Complemental strand, 46088064 - 46088005
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46088064 |
tttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
46088005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 122 - 180
Target Start/End: Complemental strand, 11693123 - 11693065
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
11693123 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtccctgt |
11693065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 122 - 180
Target Start/End: Complemental strand, 13479613 - 13479555
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13479613 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
13479555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 123 - 212
Target Start/End: Complemental strand, 13530714 - 13530625
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
13530714 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
13530625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 127 - 236
Target Start/End: Original strand, 20144423 - 20144531
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattttg |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| ||||||| |||||| || |||||||||||||||||||||||| ||| ||||| |
|
|
| T |
20144423 |
taaaatatggttttggtccctgcaaatatgcctcgttttagttttagaccctgtaattttttgtt-ttgtttttggtccctgcaaatatgtctcgttttg |
20144521 |
T |
 |
| Q |
227 |
gttttggtcc |
236 |
Q |
| |
|
|||||||||| |
|
|
| T |
20144522 |
gttttggtcc |
20144531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 122 - 180
Target Start/End: Complemental strand, 23245597 - 23245539
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23245597 |
taggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctgt |
23245539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 123 - 212
Target Start/End: Original strand, 24774044 - 24774133
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
24774044 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttattgtttttggtccttgcaaa |
24774133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 118 - 180
Target Start/End: Original strand, 42823770 - 42823832
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42823770 |
attttaggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtacctgt |
42823832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 123 - 212
Target Start/End: Complemental strand, 43231390 - 43231301
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
43231390 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
43231301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 125 - 235
Target Start/End: Complemental strand, 44925844 - 44925732
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt--nnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
|||||||||||||||||||| | ||||||||| ||||||||||||||||||||||| || ||||||||||||||||||||||||||| || |
|
|
| T |
44925844 |
gctaaaatatggttttggtctccgcaaatatgcctcgttttggttttagtccctgtaaattttttttttgttgtttttggtccctgcaaatatgcctaat |
44925745 |
T |
 |
| Q |
223 |
tttggttttggtc |
235 |
Q |
| |
|
||||||||||||| |
|
|
| T |
44925744 |
tttggttttggtc |
44925732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 127 - 236
Target Start/End: Original strand, 47135781 - 47135890
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattttg |
226 |
Q |
| |
|
||||| ||| |||||||| ||| |||||| |||||||||||||||||| ||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
47135781 |
taaaacatgattttggtctctgtaaatatatctcgttttggttttagttcctgtaaaaaaaatttgttgtttttggtccctgcaaatatgcctcattttg |
47135880 |
T |
 |
| Q |
227 |
gttttggtcc |
236 |
Q |
| |
|
|||||||||| |
|
|
| T |
47135881 |
gttttggtcc |
47135890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 5827974 - 5827917
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5827974 |
aggctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccctgt |
5827917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 122 - 179
Target Start/End: Original strand, 9289264 - 9289321
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9289264 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
9289321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 124 - 212
Target Start/End: Complemental strand, 19321859 - 19321771
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
19321859 |
ggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
19321771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 122 - 179
Target Start/End: Original strand, 26412188 - 26412245
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26412188 |
taggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
26412245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 124 - 212
Target Start/End: Complemental strand, 31560695 - 31560607
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
31560695 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
31560607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 31812214 - 31812157
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
31812214 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctgt |
31812157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 125 - 237
Target Start/End: Complemental strand, 37557194 - 37557082
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattt |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| ||||||||||||| || ||||||||||||||| ||||| ||| || ||| |
|
|
| T |
37557194 |
gctaaaatatggttttggtccctgcaaatatacctcgttttgattttagtccctgtaatttttttttgttgtttttggtccctccaaatgtgcatcgttt |
37557095 |
T |
 |
| Q |
225 |
tggttttggtcct |
237 |
Q |
| |
|
||||||||||||| |
|
|
| T |
37557094 |
tggttttggtcct |
37557082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 42848026 - 42848083
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
42848026 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctgt |
42848083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 122 - 179
Target Start/End: Complemental strand, 53916049 - 53915992
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
53916049 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
53915992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 124 - 180
Target Start/End: Original strand, 13764613 - 13764669
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
13764613 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttaagtccctgt |
13764669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 123 - 179
Target Start/End: Original strand, 29499181 - 29499237
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29499181 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29499237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 30046793 - 30046737
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30046793 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
30046737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 30061134 - 30061078
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30061134 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
30061078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 124 - 180
Target Start/End: Original strand, 46115414 - 46115470
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
46115414 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
46115470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 124 - 180
Target Start/End: Original strand, 46128548 - 46128604
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
46128548 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
46128604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 124 - 180
Target Start/End: Complemental strand, 53308068 - 53308012
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
53308068 |
ggctaaaatatggttttggtccctgcaaatatgtcccgttttggttttagtccctgt |
53308012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 117 - 176
Target Start/End: Complemental strand, 13074132 - 13074073
Alignment:
| Q |
117 |
gattttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
13074132 |
gattttaggctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtcc |
13074073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 122 - 212
Target Start/End: Original strand, 14487800 - 14487890
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||| || |||||||||||||||||||| |
|
|
| T |
14487800 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
14487890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 126 - 212
Target Start/End: Complemental strand, 19903653 - 19903567
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||| || |||||||||||||||||||| |
|
|
| T |
19903653 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccatgtaaaaaaattttgttgtttttggtccctgcaaa |
19903567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 24474964 - 24474909
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24474964 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
24474909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 124 - 179
Target Start/End: Complemental strand, 50714565 - 50714510
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50714565 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
50714510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 121 - 180
Target Start/End: Complemental strand, 52430103 - 52430044
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
52430103 |
ttaggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtccctgt |
52430044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 118 - 180
Target Start/End: Original strand, 4279016 - 4279078
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4279016 |
attttaggctaaaatatggttttagcccctgcaaatatatctcgttttggttttagtccctgt |
4279078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 122 - 236
Target Start/End: Original strand, 11692760 - 11692873
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctca |
221 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| | ||||||| ||||||||||| | || |||||||||||||||||||||||||||| |
|
|
| T |
11692760 |
taggctaaaatgtggttttggtccctgcaaatatgccccgttttgattttagtccctat-aattttttttgttgtttttggtccctgcaaatatgcctcg |
11692858 |
T |
 |
| Q |
222 |
ttttggttttggtcc |
236 |
Q |
| |
|
||||| ||||||||| |
|
|
| T |
11692859 |
ttttgattttggtcc |
11692873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 121 - 179
Target Start/End: Original strand, 35763644 - 35763702
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35763644 |
ttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
35763702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 118 - 235
Target Start/End: Complemental strand, 42824097 - 42823980
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgc |
217 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||| |||||| ||||||||| ||| || ||||||| |||||||||| ||||| |
|
|
| T |
42824097 |
atttttggctaaaatatggttttggtccctgcaaatatgtcttgttttgattttagtccttgtaaaaaaaaattgttgttttaggtccctgcacatatgt |
42823998 |
T |
 |
| Q |
218 |
ctcattttggttttggtc |
235 |
Q |
| |
|
||| ||||| |||||||| |
|
|
| T |
42823997 |
ctcgttttgattttggtc |
42823980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 122 - 180
Target Start/End: Original strand, 51738135 - 51738193
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
51738135 |
taggctaaaatatggttttggtccctacaaatatgtctcgttttggttttactccctgt |
51738193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 122 - 180
Target Start/End: Original strand, 52441761 - 52441819
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
52441761 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt |
52441819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 122 - 179
Target Start/End: Original strand, 4211559 - 4211616
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
4211559 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctg |
4211616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 122 - 179
Target Start/End: Complemental strand, 9289641 - 9289584
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9289641 |
taggcttaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
9289584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 119 - 180
Target Start/End: Original strand, 13064154 - 13064215
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
13064154 |
ttttaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgt |
13064215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 13064466 - 13064409
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
13064466 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
13064409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 119 - 176
Target Start/End: Original strand, 14594201 - 14594258
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
14594201 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcactttggttttagtcc |
14594258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 16712692 - 16712635
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16712692 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
16712635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 22099913 - 22099856
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
22099913 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtctctgt |
22099856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 119 - 236
Target Start/End: Original strand, 26313983 - 26314102
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt--nnnnnnnnnttattgtttttggtccctgcaaatatg |
216 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| || |||||||||||||||| ||||||| |
|
|
| T |
26313983 |
tttttggctaaaatatggttttgatccctgcaaatatgttccgttttggttttagtccctgtaatttttttttttgttgtttttggtccctgaaaatatg |
26314082 |
T |
 |
| Q |
217 |
cctcattttggttttggtcc |
236 |
Q |
| |
|
||| ||||||||||||||| |
|
|
| T |
26314083 |
tctcgttttggttttggtcc |
26314102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 26314333 - 26314276
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
26314333 |
aggctaaaatatggttttgatccctgaaaatatgtctcgttttggttttagtccctgt |
26314276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 176
Target Start/End: Complemental strand, 29380911 - 29380858
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
29380911 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
29380858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 32365484 - 32365427
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32365484 |
aggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctgt |
32365427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 176
Target Start/End: Original strand, 34361802 - 34361855
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34361802 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
34361855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 118 - 179
Target Start/End: Complemental strand, 35415639 - 35415578
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35415639 |
atttttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
35415578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 36701999 - 36702056
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
36701999 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt |
36702056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 119 - 180
Target Start/End: Complemental strand, 45593591 - 45593530
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45593591 |
ttttaggctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagttcctgt |
45593530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 52017504 - 52017561
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
52017504 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
52017561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 52017871 - 52017814
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
52017871 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
52017814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 52442093 - 52442036
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
52442093 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccctgt |
52442036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 120 - 180
Target Start/End: Original strand, 32365090 - 32365150
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
32365090 |
tttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt |
32365150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 123 - 179
Target Start/End: Original strand, 41345852 - 41345908
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
41345852 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
41345908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 123 - 175
Target Start/End: Original strand, 44925484 - 44925536
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
175 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
44925484 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtc |
44925536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 124 - 180
Target Start/End: Complemental strand, 53717174 - 53717118
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
53717174 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
53717118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 124 - 235
Target Start/End: Complemental strand, 55805088 - 55804977
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcatt |
223 |
Q |
| |
|
||||||||||| |||||||| | |||||||||| || |||||||||||||||| || || ||||||||||||||||||||||||| ||||| |
|
|
| T |
55805088 |
ggctaaaatatagttttggttcttgcaaatatgccttgttttggttttagtccatgcaaattttttttgttgtttttggtccctgcaaatatgcatcatt |
55804989 |
T |
 |
| Q |
224 |
ttggttttggtc |
235 |
Q |
| |
|
|||||||||||| |
|
|
| T |
55804988 |
ttggttttggtc |
55804977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 18205155 - 18205210
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
18205155 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
18205210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 124 - 179
Target Start/End: Complemental strand, 25358540 - 25358485
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
25358540 |
ggctaaaatatgattttggtccctgtaaatatgtctcgttttggttttagtccctg |
25358485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 32208541 - 32208596
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32208541 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
32208596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 124 - 179
Target Start/End: Original strand, 46292392 - 46292447
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
46292392 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctg |
46292447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 127 - 178
Target Start/End: Original strand, 47022743 - 47022794
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
47022743 |
taaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccct |
47022794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 125 - 176
Target Start/End: Complemental strand, 47136170 - 47136119
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
47136170 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
47136119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 146 - 235
Target Start/End: Complemental strand, 5203271 - 5203182
Alignment:
| Q |
146 |
ctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattttggttttggtc |
235 |
Q |
| |
|
|||||||||||||| |||||||||||||||| || || ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5203271 |
ctgcaaatatgtcttgttttggttttagtccttgcaaattatttttgttgtttttggtccctgcaaatatgcctcattttggttttggtc |
5203182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 122 - 180
Target Start/End: Original strand, 12152152 - 12152210
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
12152152 |
taggctaaaatatggttttggtccctgcaaatatgactcgtttaagttttagtccctgt |
12152210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 126 - 180
Target Start/End: Complemental strand, 18205521 - 18205467
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
18205521 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgt |
18205467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 122 - 180
Target Start/End: Original strand, 20291984 - 20292042
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
20291984 |
taggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtctctgt |
20292042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 122 - 180
Target Start/End: Original strand, 22584285 - 22584343
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
22584285 |
taggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtctctgt |
22584343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 123 - 212
Target Start/End: Complemental strand, 23779226 - 23779137
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
23779226 |
aggctaaaatatggttttaatccctgcaaatatgtctcattttggttttagtccctgtcaattttttttgttgtttttggtccctgcaaa |
23779137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 122 - 176
Target Start/End: Complemental strand, 35119613 - 35119559
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
35119613 |
taggctaaaatatggttttggtcactgcaaatatgtctcgttttggtttcagtcc |
35119559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 126 - 180
Target Start/End: Complemental strand, 35420701 - 35420647
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
35420701 |
ctaaaatatggttttggtccttgcaaatatgtctcgatttggttttagtccctgt |
35420647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 122 - 176
Target Start/End: Complemental strand, 41346220 - 41346166
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
41346220 |
taggctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtcc |
41346166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 126 - 180
Target Start/End: Original strand, 43368467 - 43368521
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
43368467 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgt |
43368521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 122 - 180
Target Start/End: Complemental strand, 51545971 - 51545913
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
51545971 |
taggttaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
51545913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 121 - 175
Target Start/End: Original strand, 51708690 - 51708744
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
175 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
51708690 |
ttaggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtc |
51708744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 122 - 176
Target Start/End: Original strand, 53716919 - 53716973
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
53716919 |
taggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtcc |
53716973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 122 - 179
Target Start/End: Original strand, 123532 - 123589
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
123532 |
taggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
123589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 2180219 - 2180276
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
2180219 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgt |
2180276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 127 - 180
Target Start/End: Original strand, 5797484 - 5797537
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
5797484 |
taaaatatgattttggtctctgcaaatatgtctcgttttggttttagtccctgt |
5797537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 8760603 - 8760660
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8760603 |
aggctaaaatatagttttactccctgcaaatatgtctcgttttggttttagtccctgt |
8760660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 8760782 - 8760725
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
8760782 |
aggctaaaatatggttttagtccttgcaaatatggctcgttttggttttagtccctgt |
8760725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 125 - 178
Target Start/End: Original strand, 13479273 - 13479326
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
13479273 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttactccct |
13479326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 176
Target Start/End: Complemental strand, 13764808 - 13764755
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
13764808 |
aggctaaaatatggttttggtccctgtaaatatgtttcgttttggttttagtcc |
13764755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 119 - 180
Target Start/End: Original strand, 28809006 - 28809067
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||| ||||||||||||||||| |||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
28809006 |
tttttggctaaaatatggttttagtccttgcaaatatgtatcgttttggttttagtccctgt |
28809067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 29463914 - 29463857
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
29463914 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttggtccctgt |
29463857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 35119291 - 35119348
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35119291 |
aggctaaaatatggttttggtccctgcaaatatgctccgttttggttttagtccctgt |
35119348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 36054151 - 36054094
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
36054151 |
aggctaaaatacggttttggtccctgcaaatatgcctcattttggttttagtccctgt |
36054094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 127 - 180
Target Start/End: Original strand, 38054549 - 38054602
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38054549 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
38054602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 119 - 180
Target Start/End: Complemental strand, 41324895 - 41324834
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||| |||||||||||||||||| || ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41324895 |
tttttggctaaaatatggttttgatctctgcaaatatgcctcgttttggttttagtccctgt |
41324834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 122 - 179
Target Start/End: Original strand, 41619897 - 41619954
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
41619897 |
taggttaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
41619954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 45505599 - 45505656
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
45505599 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgt |
45505656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 45505895 - 45505838
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
45505895 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt |
45505838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 118 - 179
Target Start/End: Original strand, 50714234 - 50714295
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
50714234 |
atttttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
50714295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 172
Target Start/End: Original strand, 52543421 - 52543470
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
172 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
52543421 |
aggctaaaatatggttttggtccttgcaaatatgtctcgttttggtttta |
52543470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 55072388 - 55072445
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
55072388 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgt |
55072445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 120 - 180
Target Start/End: Original strand, 5882548 - 5882607
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
5882548 |
tttaggctaaaatatggttttagtcc-tgcaaatatgcctcgttttggttttagtccctgt |
5882607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 6827875 - 6827819
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6827875 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
6827819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 127 - 179
Target Start/End: Original strand, 15555506 - 15555558
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
15555506 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
15555558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 124 - 176
Target Start/End: Original strand, 22099543 - 22099595
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
22099543 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
22099595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 124 - 180
Target Start/End: Original strand, 27008084 - 27008140
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27008084 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
27008140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 123 - 179
Target Start/End: Original strand, 29380667 - 29380723
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
29380667 |
aggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttggtccctg |
29380723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 129 - 180
Target Start/End: Original strand, 2034544 - 2034595
Alignment:
| Q |
129 |
aaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2034544 |
aaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgt |
2034595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 125 - 180
Target Start/End: Original strand, 2322094 - 2322149
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||||||||||||||||| ||||| |
|
|
| T |
2322094 |
gctaaaatatggttttggtccctacaaatatgcctcgttttggttttagtacctgt |
2322149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 125 - 180
Target Start/End: Original strand, 11285504 - 11285559
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11285504 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt |
11285559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 123 - 174
Target Start/End: Original strand, 23778963 - 23779014
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
174 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
23778963 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
23779014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 193 - 236
Target Start/End: Complemental strand, 24774358 - 24774315
Alignment:
| Q |
193 |
ttgtttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24774358 |
ttgtttttggtccctgcaaatatgcctcattttggttttggtcc |
24774315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #149
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 28809181 - 28809126
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28809181 |
aggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccct |
28809126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #150
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 117 - 176
Target Start/End: Complemental strand, 41921091 - 41921032
Alignment:
| Q |
117 |
gattttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||| |||||||||||||||||| | |||||||||||||| |||||||||||||||||| |
|
|
| T |
41921091 |
gatttaaggctaaaatatggttttagcccctgcaaatatgtttcgttttggttttagtcc |
41921032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #151
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 129 - 180
Target Start/End: Complemental strand, 47532667 - 47532616
Alignment:
| Q |
129 |
aaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
47532667 |
aaatatggttttggtccttgcaaatatgtctcgttttggttttagttcctgt |
47532616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #152
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 120 - 179
Target Start/End: Complemental strand, 51738415 - 51738356
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||| |||| ||||||| |
|
|
| T |
51738415 |
tttaggctaaaatatggttttggtccatgcaaatatgcctcgttttgattttggtccctg |
51738356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #153
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 126 - 180
Target Start/End: Original strand, 9445951 - 9446005
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||| |||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9445951 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt |
9446005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #154
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 125 - 175
Target Start/End: Complemental strand, 15555637 - 15555587
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
175 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
15555637 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagtc |
15555587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #155
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 126 - 180
Target Start/End: Complemental strand, 18831176 - 18831122
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
18831176 |
ctaaaatatggttttagtccctgtaaatatgtcttgttttggttttagtccctgt |
18831122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #156
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 126 - 180
Target Start/End: Original strand, 30564835 - 30564889
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||| |||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
30564835 |
ctaaaatatggttttagtccctgcaaatatgttttgttttggttttagtccctgt |
30564889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #157
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 122 - 180
Target Start/End: Complemental strand, 34355285 - 34355227
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
34355285 |
taggctaaaatatggttttagtccctcaaaatatgactcgttttggttttagtccctgt |
34355227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #158
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 127 - 212
Target Start/End: Original strand, 50753925 - 50754010
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| |||||||||||||| ||||| || |||||||||||||||||||| |
|
|
| T |
50753925 |
taaaatatggttttggtccctgcaaatatatcttgttttggttttagttcctgtaaatttcttttgttgtttttggtccctgcaaa |
50754010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #159
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 122 - 180
Target Start/End: Complemental strand, 55072714 - 55072656
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
55072714 |
taggttaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctgt |
55072656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #160
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 123 - 176
Target Start/End: Complemental strand, 5052585 - 5052532
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5052585 |
aggctacaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
5052532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #161
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 123 - 172
Target Start/End: Original strand, 8904885 - 8904934
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
172 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
8904885 |
aggctaaaatatagttttggtccctgcaaatatgcctcgttttggtttta |
8904934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #162
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 124 - 236
Target Start/End: Complemental strand, 8905234 - 8905123
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcatt |
223 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||| ||||| ||||| ||||| | || |||||||||||||||||||||||| ||| || |
|
|
| T |
8905234 |
ggctaaaatatggttttggtccctgtaaatatgcctcattttgattttaatccct-ttaatttttttttttgtttttggtccctgcaaatatgtctcgtt |
8905136 |
T |
 |
| Q |
224 |
ttggttttggtcc |
236 |
Q |
| |
|
|||||||| |||| |
|
|
| T |
8905135 |
ttggttttcgtcc |
8905123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #163
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 119 - 180
Target Start/End: Complemental strand, 9446328 - 9446267
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||| |||||||||||| |||| ||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
9446328 |
ttttcggctaaaatatgattttagtccctgtaaatatgtctcgttttggttttcgtccctgt |
9446267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #164
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 127 - 180
Target Start/End: Original strand, 14791502 - 14791555
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
| T |
14791502 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtctctgt |
14791555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #165
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 123 - 172
Target Start/End: Complemental strand, 28449215 - 28449166
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
172 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
28449215 |
aggctaaaatatggttttggtccttgcaaatatgtctcgttttgatttta |
28449166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #166
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 31182505 - 31182448
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31182505 |
aggctaaaatatggttttaattcctgcaaatatgtctcgttttggtttcagtccctgt |
31182448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #167
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 122 - 179
Target Start/End: Original strand, 35415297 - 35415354
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
35415297 |
taggctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtccctg |
35415354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #168
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 122 - 179
Target Start/End: Complemental strand, 35763957 - 35763900
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||| |||| ||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
35763957 |
taggctaaaatatgattttagtccctgcagatatgcctcgttttggttttagtccctg |
35763900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #169
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 46292652 - 46292595
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| |||||||||||||| |||| |
|
|
| T |
46292652 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtctctgt |
46292595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #170
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 51545628 - 51545685
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
51545628 |
aggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtctctgt |
51545685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #171
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 124 - 176
Target Start/End: Complemental strand, 4279335 - 4279283
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4279335 |
ggctaaaatatgattttagtccctgcaaatatggctcgttttggttttagtcc |
4279283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #172
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 127 - 178
Target Start/End: Original strand, 5202929 - 5202981
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcg-ttttggttttagtccct |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
5202929 |
taaaatatggttttggtccctgcaaatatgcctcgtttttggttttagtccct |
5202981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #173
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 123 - 175
Target Start/End: Original strand, 6827545 - 6827597
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
175 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| |||||||||||||||||| |
|
|
| T |
6827545 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc |
6827597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #174
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 124 - 180
Target Start/End: Complemental strand, 8191391 - 8191335
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||| ||||| ||||||||| |
|
|
| T |
8191391 |
ggctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtccctgt |
8191335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #175
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 120 - 180
Target Start/End: Complemental strand, 22584611 - 22584551
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||| ||||||| ||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
22584611 |
tttaggctaaaatgtggttttagtctctgcaaatatgcttcgttttggttttagtccctgt |
22584551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #176
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 123 - 179
Target Start/End: Original strand, 27427871 - 27427926
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||| | |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
27427871 |
aggctaaaatatggtttag-tccctgcaaatatggctcgttttggttttagtccctg |
27427926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #177
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 126 - 238
Target Start/End: Original strand, 35420393 - 35420507
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg--tnnnnnnnnnttattgtttttggtccctgcaaatatgcctcatt |
223 |
Q |
| |
|
||||||||||||||||||||| ||||||||| | ||||||||||||||||||| | || |||||| | || |||||||||||| |||||| |
|
|
| T |
35420393 |
ctaaaatatggttttggtccccgcaaatatgctttgttttggttttagtccctgtatttttttttgttgttgtttgttgttcctgcaaatatgtctcatt |
35420492 |
T |
 |
| Q |
224 |
ttggttttggtcctt |
238 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
35420493 |
ttggttttggtcctt |
35420507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #178
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 41620257 - 41620201
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
41620257 |
aggctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtccctg |
41620201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #179
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 118 - 174
Target Start/End: Complemental strand, 47274236 - 47274180
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
174 |
Q |
| |
|
||||| ||||||||||| ||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
47274236 |
atttttggctaaaatatagttttagttcctgcaaatatgtctcgttttggttttagt |
47274180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #180
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 123 - 175
Target Start/End: Complemental strand, 51709028 - 51708976
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
175 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
51709028 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtc |
51708976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #181
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 124 - 180
Target Start/End: Complemental strand, 55482468 - 55482412
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||| |||| |||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
55482468 |
ggctaaaatatgattttagtccctccaaatatgcctcgttttggttttagtccctgt |
55482412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #182
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 125 - 172
Target Start/End: Original strand, 7639897 - 7639944
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
172 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
7639897 |
gctaaaatatggttttggtccctacaaatatgtcttgttttggtttta |
7639944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #183
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 129 - 180
Target Start/End: Complemental strand, 27008401 - 27008350
Alignment:
| Q |
129 |
aaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||| ||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27008401 |
aaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgt |
27008350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #184
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 32208902 - 32208847
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
32208902 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttgattttagtccct |
32208847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #185
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 125 - 180
Target Start/End: Complemental strand, 36702362 - 36702307
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||| || |||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
36702362 |
gctaaaatatggttttagttcctgcagatatgcctcgttttggttttagtccctgt |
36702307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #186
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 121 - 180
Target Start/End: Original strand, 45593225 - 45593284
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||| ||||| |||||| |||||||| |||||||||| |||||||||||| |
|
|
| T |
45593225 |
ttaggctaaaatatagttttagtccctacaaatatgcctcgttttggctttagtccctgt |
45593284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #187
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 128 - 236
Target Start/End: Complemental strand, 14594561 - 14594455
Alignment:
| Q |
128 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattttgg |
227 |
Q |
| |
|
|||||||| |||| |||||| ||||||| ||| |||||||||||||| ||||| || ||||||||||||||||||||||| ||| |||||| |
|
|
| T |
14594561 |
aaaatatgattttagtccctccaaatatttcttgttttggttttagttcctgtaatttttgttt--tgtttttggtccctgcaaatatgtctcgttttgg |
14594464 |
T |
 |
| Q |
228 |
ttttggtcc |
236 |
Q |
| |
|
||||||||| |
|
|
| T |
14594463 |
ttttggtcc |
14594455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #188
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 20144492 - 20144534
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
20144492 |
ttttggtccctgcaaatatgtctcgttttggttttggtccctg |
20144534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #189
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 118 - 180
Target Start/End: Complemental strand, 50754262 - 50754200
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||| || | |||||| ||||||||||||||| |
|
|
| T |
50754262 |
attttaggctaaaatatggttttgatcactgcaaacatatatcgtttaggttttagtccctgt |
50754200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #190
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 123 - 212
Target Start/End: Original strand, 51762869 - 51762958
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||| || ||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
51762869 |
aggctaaaatatggtattggtctctgcaaatatgcttcattttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
51762958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #191
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 126 - 180
Target Start/End: Original strand, 51830891 - 51830945
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||| ||||| ||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
51830891 |
ctaaaatatagttttagtccctgcatatatgtcttgttttggttttagtccctgt |
51830945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #192
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 137 - 178
Target Start/End: Complemental strand, 14594494 - 14594453
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
14594494 |
ttttggtccctgcaaatatgtctcgttttggttttggtccct |
14594453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #193
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 123 - 172
Target Start/End: Complemental strand, 20144732 - 20144683
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
172 |
Q |
| |
|
||||||||||||||||||||| | |||||||||| ||||||||||||||| |
|
|
| T |
20144732 |
aggctaaaatatggttttggttcatgcaaatatgcctcgttttggtttta |
20144683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #194
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 122 - 175
Target Start/End: Original strand, 28448832 - 28448885
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
175 |
Q |
| |
|
||||||||||||||||||| |||| | |||||||| |||||||||||||||||| |
|
|
| T |
28448832 |
taggctaaaatatggttttagtccttacaaatatgcctcgttttggttttagtc |
28448885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #195
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 45474597 - 45474540
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| ||||||||||||| |||| |
|
|
| T |
45474597 |
aggctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagtctctgt |
45474540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #196
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 137 - 178
Target Start/End: Complemental strand, 54903403 - 54903362
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
54903403 |
ttttggtccctgcaaatatgtctcgttttggttttggtccct |
54903362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #197
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 129 - 177
Target Start/End: Complemental strand, 123893 - 123845
Alignment:
| Q |
129 |
aaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
177 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
123893 |
aaatatggttttagtccctgcaaatatgcctcattttggttttagtccc |
123845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #198
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 137 - 177
Target Start/End: Complemental strand, 2034781 - 2034741
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccc |
177 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2034781 |
ttttggtccctgcaaatatgtctcattttggttttagtccc |
2034741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #199
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 124 - 176
Target Start/End: Complemental strand, 2180572 - 2180520
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||| | ||||||||||||||||| |
|
|
| T |
2180572 |
ggctaaaatatagttttagtccctgcaaatatggcacgttttggttttagtcc |
2180520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #200
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 197 - 236
Target Start/End: Original strand, 4211574 - 4211613
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4211574 |
ttttggtccctgcaaatatgcctcgttttggttttggtcc |
4211613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #201
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 197 - 236
Target Start/End: Original strand, 14487815 - 14487854
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
14487815 |
ttttggtccctgcaaatatgcctcgttttggttttggtcc |
14487854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #202
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 36054137 - 36054098
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36054137 |
ttttggtccctgcaaatatgcctcattttggttttagtcc |
36054098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #203
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 197 - 236
Target Start/End: Original strand, 46292405 - 46292444
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
46292405 |
ttttggtccctgcaaatatgcctcgttttggttttggtcc |
46292444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #204
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 7642580 - 7642538
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
7642580 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
7642538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #205
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 197 - 231
Target Start/End: Original strand, 14791512 - 14791546
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggtttt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
14791512 |
ttttggtccctgcaaatatgcctcattttggtttt |
14791546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #206
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 126 - 180
Target Start/End: Original strand, 16712331 - 16712385
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||| |||||| |||| |
|
|
| T |
16712331 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtattagtctctgt |
16712385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #207
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 23245304 - 23245346
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
23245304 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
23245346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #208
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 118 - 176
Target Start/End: Original strand, 24474594 - 24474651
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||| |||||||||||||||||| |||| |||||||||| |||||||||||||||||| |
|
|
| T |
24474594 |
atttcaggctaaaatatggttttagtcc-tgcaaatatgcatcgttttggttttagtcc |
24474651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #209
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 26412511 - 26412469
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
26412511 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
26412469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #210
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 29499473 - 29499431
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
29499473 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
29499431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #211
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 30060842 - 30060884
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
30060842 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
30060884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #212
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 31560404 - 31560446
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
31560404 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
31560446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #213
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 35464309 - 35464267
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
35464309 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
35464267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #214
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 36050359 - 36050401
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
36050359 |
ttttggtccctgcaaatatgcctcgttttggttttggtccctg |
36050401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #215
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 122 - 180
Target Start/End: Original strand, 37556839 - 37556897
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||| | || ||||||||| |||| |||||||||||||||||| |
|
|
| T |
37556839 |
taggctaaaatatggttttagaccttgcaaatatacctcgatttggttttagtccctgt |
37556897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #216
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 42848318 - 42848276
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
42848318 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
42848276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #217
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 43231161 - 43231203
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
43231161 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
43231203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #218
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 126 - 236
Target Start/End: Complemental strand, 52543725 - 52543617
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcatttt |
225 |
Q |
| |
|
|||||||||| ||||||| | |||||||||| ||||||||||||||| ||| ||| || || ||||| ||||||||||||||| |||||||| |
|
|
| T |
52543725 |
ctaaaatatgattttggttcttgcaaatatgcctcgttttggttttaatccatgt--aatttttttttttttttttgtccctgcaaatatgtctcatttt |
52543628 |
T |
 |
| Q |
226 |
ggttttggtcc |
236 |
Q |
| |
|
| ||||||||| |
|
|
| T |
52543627 |
gattttggtcc |
52543617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #219
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 53915756 - 53915798
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
53915756 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
53915798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #220
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 18136114 - 18136057
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||| ||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
18136114 |
aggctaaaatatgactttaatccctacaaatatgcctcgttttggttttagtccctgt |
18136057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #221
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 134 - 179
Target Start/End: Complemental strand, 25358499 - 25358454
Alignment:
| Q |
134 |
tggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
25358499 |
tggttttagtccctgcaaatatgtctcgttttggttgtggtccctg |
25358454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #222
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 127 - 235
Target Start/End: Complemental strand, 28197278 - 28197170
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattttg |
226 |
Q |
| |
|
|||||||||||||| ||| || |||||||||||||| || |||||||||||| || | ||||||||||||||||| |||| ||| ||||| |
|
|
| T |
28197278 |
taaaatatggttttagtctctacaaatatgtctcgtctttgttttagtccctacaatttttttttgtagtttttggtccctgcaagtatgtctcgttttg |
28197179 |
T |
 |
| Q |
227 |
gttttggtc |
235 |
Q |
| |
|
||||||||| |
|
|
| T |
28197178 |
gttttggtc |
28197170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #223
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 122 - 233
Target Start/End: Original strand, 41439785 - 41439897
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt-nnnnnnnnnttattgtttttggtccctgcaaatatgcctc |
220 |
Q |
| |
|
|||| |||||||||||||| | | ||| |||||| ||||||||||||||||||| |||| |||||||||||||||| || ||||| ||||| |
|
|
| T |
41439785 |
taggttaaaatatggttttagcctctgtaaatatttctcgttttggttttagtctctgtaatttttattttattgtttttggtccttgtaaataagcctc |
41439884 |
T |
 |
| Q |
221 |
attttggttttgg |
233 |
Q |
| |
|
|||||||||||| |
|
|
| T |
41439885 |
gttttggttttgg |
41439897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #224
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 134 - 171
Target Start/End: Original strand, 43231189 - 43231226
Alignment:
| Q |
134 |
tggttttggtccctgcaaatatgtctcgttttggtttt |
171 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43231189 |
tggttttggtccctgcaaatatgtctcattttggtttt |
43231226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #225
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 197 - 238
Target Start/End: Complemental strand, 47136158 - 47136117
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcctt |
238 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
47136158 |
ttttggtccctgcaaatatgtctcattttggttttagtcctt |
47136117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #226
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 49123322 - 49123265
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||| ||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
49123322 |
aggctaaaatatgactttaatccctacaaatatgcctcgttttggttttagtccctgt |
49123265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #227
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 50822295 - 50822238
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||| | ||| ||||||||||||| |
|
|
| T |
50822295 |
aggctaaaatatggttttactccatgcaaatatgtctcatgttgattttagtccctgt |
50822238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #228
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 124 - 172
Target Start/End: Original strand, 29463610 - 29463658
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
172 |
Q |
| |
|
||||||||||||||||| | |||||||||||| ||||||||||||||| |
|
|
| T |
29463610 |
ggctaaaatatggttttatttcctgcaaatatgcctcgttttggtttta |
29463658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #229
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 122 - 174
Target Start/End: Original strand, 31370802 - 31370854
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
174 |
Q |
| |
|
||||||||||||||||||| || |||| |||||| ||||||||||||||||| |
|
|
| T |
31370802 |
taggctaaaatatggttttagtgtctgcgaatatgcctcgttttggttttagt |
31370854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #230
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 192 - 232
Target Start/End: Original strand, 43200039 - 43200078
Alignment:
| Q |
192 |
attgtttttggtccctgcaaatatgcctcattttggttttg |
232 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43200039 |
attgtttttggtcc-tgcaaatatgcctcattttggttttg |
43200078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #231
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 124 - 180
Target Start/End: Complemental strand, 43368777 - 43368721
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| | || |||||||||| |||||||||||||||| ||||| |
|
|
| T |
43368777 |
ggctaaaatatggttttaattccggcaaatatgtttcgttttggttttagttcctgt |
43368721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #232
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 127 - 179
Target Start/End: Original strand, 50822013 - 50822065
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||| ||||||| ||||||| || |||||||||||||||||| |
|
|
| T |
50822013 |
taaaatatggttttagtccctgtaaatatgattcattttggttttagtccctg |
50822065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #233
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 139 - 171
Target Start/End: Original strand, 53307829 - 53307861
Alignment:
| Q |
139 |
ttggtccctgcaaatatgtctcgttttggtttt |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
53307829 |
ttggtccctgcaaatatgtctcgttttggtttt |
53307861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #234
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Original strand, 123547 - 123586
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
123547 |
ttttagtccctgcaaatatgcctcattttggttttagtcc |
123586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #235
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 123885 - 123846
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
123885 |
ttttagtccctgcaaatatgcctcattttggttttagtcc |
123846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #236
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Original strand, 2034552 - 2034591
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
2034552 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
2034591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #237
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Original strand, 2180233 - 2180272
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
2180233 |
ttttagtccctgcaaatatgcctcattttggttttagtcc |
2180272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #238
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 125 - 180
Target Start/End: Original strand, 8191076 - 8191131
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||| |||| ||||| ||||||||||| ||||| |||||||||||||| |
|
|
| T |
8191076 |
gctaaaatatgattttaatccctacaaatatgtcttgttttagttttagtccctgt |
8191131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #239
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 12152480 - 12152441
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
12152480 |
ttttggtccctgcaaatatgtctcgttttggttttggtcc |
12152441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #240
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 13530700 - 13530661
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
13530700 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
13530661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #241
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 124 - 179
Target Start/End: Original strand, 22204055 - 22204110
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| | |||| |||||||||||||| |
|
|
| T |
22204055 |
ggctaaaatatgtttttggtccctgcaaatatagcgagtttgggttttagtccctg |
22204110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #242
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Original strand, 24774058 - 24774097
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
24774058 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
24774097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #243
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 29463900 - 29463861
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
29463900 |
ttttagtccctgcaaatatgcctcgttttggttttggtcc |
29463861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #244
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Original strand, 29499195 - 29499234
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
29499195 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
29499234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #245
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 30046779 - 30046740
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
30046779 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
30046740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #246
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 30061120 - 30061081
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
30061120 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
30061081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #247
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 125 - 176
Target Start/End: Original strand, 30890832 - 30890883
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||| |||| |||||||||| |
|
|
| T |
30890832 |
gctaaaatatggttatgatccctgcaaatatgtcttattttagttttagtcc |
30890883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #248
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 193 - 232
Target Start/End: Original strand, 31182194 - 31182233
Alignment:
| Q |
193 |
ttgtttttggtccctgcaaatatgcctcattttggttttg |
232 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
31182194 |
ttgtttttggtccctgcgaatatgtctcattttggttttg |
31182233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #249
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 31560682 - 31560643
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
31560682 |
ttttggtccctgcaaatatgtctcattttggttttagtcc |
31560643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #250
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 127 - 174
Target Start/End: Original strand, 41920771 - 41920818
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
174 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||| ||||| ||||||| |
|
|
| T |
41920771 |
taaaatatggttttagtccctgcaaatatgactcattttgattttagt |
41920818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #251
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 43231376 - 43231337
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
43231376 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
43231337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #252
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Original strand, 46115427 - 46115466
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
46115427 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
46115466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #253
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Original strand, 46128561 - 46128600
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
46128561 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
46128600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #254
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Original strand, 50714253 - 50714292
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
50714253 |
ttttagtccctgcaaatatgcctcattttggttttagtcc |
50714292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #255
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 5797747 - 5797705
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||||| |
|
|
| T |
5797747 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
5797705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #256
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 5827728 - 5827770
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
5827728 |
ttttgatccctgaaaatatgtctcgttttggttttggtccctg |
5827770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #257
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 197 - 231
Target Start/End: Original strand, 8904899 - 8904933
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggtttt |
231 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
8904899 |
ttttggtccctgcaaatatgcctcgttttggtttt |
8904933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #258
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 11692834 - 11692876
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||| ||||||| |
|
|
| T |
11692834 |
ttttggtccctgcaaatatgcctcgttttgattttggtccctg |
11692876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #259
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 13530452 - 13530494
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||||| |
|
|
| T |
13530452 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
13530494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #260
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 19903334 - 19903376
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
19903334 |
ttttgatccctgcaaatatgtctcattttggttttggtccctg |
19903376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #261
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 197 - 231
Target Start/End: Original strand, 20291999 - 20292033
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggtttt |
231 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
20291999 |
ttttggtccctgcaaatatgcctcgttttggtttt |
20292033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #262
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 24774354 - 24774312
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||||| |
|
|
| T |
24774354 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
24774312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #263
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 25424239 - 25424197
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||||| |
|
|
| T |
25424239 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
25424197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #264
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 122 - 156
Target Start/End: Complemental strand, 30091116 - 30091082
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatg |
156 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
30091116 |
taggctaaaatatggttttggtccatgcaaatatg |
30091082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #265
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 171
Target Start/End: Complemental strand, 30565125 - 30565091
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggtttt |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
30565125 |
ttttggtccctgcaaatatgtctcgttttgatttt |
30565091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #266
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 31811996 - 31812038
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||||| |
|
|
| T |
31811996 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
31812038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #267
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 197 - 231
Target Start/End: Original strand, 43231192 - 43231226
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggtttt |
231 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
43231192 |
ttttggtccctgcaaatatgtctcattttggtttt |
43231226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #268
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 197 - 231
Target Start/End: Complemental strand, 46292638 - 46292604
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggtttt |
231 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
46292638 |
ttttagtccctgcaaatatgcctcattttggtttt |
46292604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #269
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 47135851 - 47135893
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||||| |
|
|
| T |
47135851 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
47135893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #270
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 50754182 - 50754140
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
50754182 |
tttttgtccctgcaaatatgtcttgttttggttttggtccctg |
50754140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #271
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 197 - 231
Target Start/End: Complemental strand, 51709014 - 51708980
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggtttt |
231 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
51709014 |
ttttagtccctgcaaatatgcctcattttggtttt |
51708980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #272
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 51763129 - 51763087
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||||| |
|
|
| T |
51763129 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
51763087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #273
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 142 - 180
Target Start/End: Original strand, 54208479 - 54208517
Alignment:
| Q |
142 |
gtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
54208479 |
gtccctgcaaatatgcctcattttggttttagtccctgt |
54208517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #274
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 236
Target Start/End: Original strand, 54208479 - 54208513
Alignment:
| Q |
202 |
gtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
54208479 |
gtccctgcaaatatgcctcattttggttttagtcc |
54208513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #275
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 197 - 238
Target Start/End: Complemental strand, 5052571 - 5052530
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcctt |
238 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
5052571 |
ttttagtccctgcaaatatgcctcgttttggttttagtcctt |
5052530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #276
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 123 - 156
Target Start/End: Complemental strand, 5259211 - 5259178
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatg |
156 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
5259211 |
aggctaaaatatgtttttggtccctgcaaatatg |
5259178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #277
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 197 - 238
Target Start/End: Complemental strand, 13074112 - 13074071
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcctt |
238 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||| |||||| |
|
|
| T |
13074112 |
ttttggtccctgcaaatatacctcgttttggttttagtcctt |
13074071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #278
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 197 - 238
Target Start/End: Original strand, 22099556 - 22099597
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcctt |
238 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
22099556 |
ttttagtccctgcaaatatgcctcgttttggttttagtcctt |
22099597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #279
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 193 - 234
Target Start/End: Complemental strand, 30565129 - 30565088
Alignment:
| Q |
193 |
ttgtttttggtccctgcaaatatgcctcattttggttttggt |
234 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||| ||||||| |
|
|
| T |
30565129 |
ttgtttttggtccctgcaaatatgtctcgttttgattttggt |
30565088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #280
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 123 - 156
Target Start/End: Original strand, 34659705 - 34659738
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatg |
156 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
34659705 |
aggctaaaatatgcttttggtccctgcaaatatg |
34659738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #281
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 123 - 152
Target Start/End: Original strand, 41324768 - 41324797
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaa |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
41324768 |
aggctaaaatatggttttggtccctgcaaa |
41324797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #282
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 197 - 238
Target Start/End: Complemental strand, 41346205 - 41346164
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcctt |
238 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
41346205 |
ttttagtccctgcaaatatgtctcattttggttttagtcctt |
41346164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #283
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 119 - 155
Target Start/End: Original strand, 3879081 - 3879117
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatat |
155 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
3879081 |
ttttaggctaaaatatgcttttgatccctgcaaatat |
3879117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #284
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 122 - 178
Target Start/End: Original strand, 5720949 - 5721005
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
|||||| |||||||| |||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
5720949 |
taggcttaaatatggaaatggtccctgcaaatatctggcgttttggttttagtccct |
5721005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #285
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 123 - 163
Target Start/End: Original strand, 9836831 - 9836871
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgtt |
163 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||| ||||| |
|
|
| T |
9836831 |
aggctaaaatatggttttgatccttgcaaatatgtttcgtt |
9836871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #286
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 197 - 237
Target Start/End: Original strand, 14594219 - 14594259
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcct |
237 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||| ||||| |
|
|
| T |
14594219 |
ttttggtccctgcaaatatgtctcactttggttttagtcct |
14594259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #287
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 128 - 176
Target Start/End: Complemental strand, 20292284 - 20292237
Alignment:
| Q |
128 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||| |||||||||||||| |||||| ||| ||||||||||||||| |
|
|
| T |
20292284 |
aaaatatcgttttggtccctgc-aatatgcctcattttggttttagtcc |
20292237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #288
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 33137288 - 33137232
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||| | |||| |||||||||||||| |
|
|
| T |
33137288 |
aggctaaaatatgtttttgatccctgcaaatatagcgagtttgggttttagtccctg |
33137232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #289
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 123 - 155
Target Start/End: Original strand, 42358031 - 42358063
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatat |
155 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
42358031 |
aggctaaaatatgtttttggtccctgcaaatat |
42358063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #290
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 119 - 155
Target Start/End: Complemental strand, 42359410 - 42359374
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatat |
155 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
42359410 |
tttttggctaaaatatgtttttggtccctgcaaatat |
42359374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #291
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 119 - 155
Target Start/End: Complemental strand, 45619795 - 45619759
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatat |
155 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
45619795 |
ttttaggctaaaatatgtttttagtccctgcaaatat |
45619759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 82; Significance: 8e-39; HSPs: 245)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 124 - 236
Target Start/End: Original strand, 8298587 - 8298699
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcatt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
8298587 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaatatgcctcatt |
8298686 |
T |
 |
| Q |
224 |
ttggttttggtcc |
236 |
Q |
| |
|
||||||||||||| |
|
|
| T |
8298687 |
ttggttttggtcc |
8298699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 120 - 236
Target Start/End: Complemental strand, 3512270 - 3512154
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcct |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| || |
|
|
| T |
3512270 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtct |
3512171 |
T |
 |
| Q |
220 |
cattttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
3512170 |
cattttggttttggtcc |
3512154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 118 - 236
Target Start/End: Original strand, 13232192 - 13232310
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgc |
217 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||| |||||||||||||||| |
|
|
| T |
13232192 |
attttatgttaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaatattttgttgtttttagtccctgcaaatatgc |
13232291 |
T |
 |
| Q |
218 |
ctcattttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
13232292 |
ctcattttggttttggtcc |
13232310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 118 - 236
Target Start/End: Complemental strand, 28346764 - 28346646
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
28346764 |
attttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaatattttgttgtttttggtccctgcaaatatgt |
28346665 |
T |
 |
| Q |
218 |
ctcattttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
28346664 |
ctcattttggttttggtcc |
28346646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 123 - 236
Target Start/End: Original strand, 7420229 - 7420342
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
7420229 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaaaaagattgttgtttttagtccctgcaaatatgcctcat |
7420328 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
7420329 |
tttggttttggtcc |
7420342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 123 - 236
Target Start/End: Original strand, 11019519 - 11019632
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| ||||| |
|
|
| T |
11019519 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaatatgtctcat |
11019618 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
11019619 |
tttggttttggtcc |
11019632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 123 - 236
Target Start/End: Original strand, 20984145 - 20984258
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || |||||||||||||||||||||||| ||||| |
|
|
| T |
20984145 |
aggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaatatgtctcat |
20984244 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
20984245 |
tttggttttggtcc |
20984258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 124 - 236
Target Start/End: Original strand, 1778564 - 1778676
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcatt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| ||||||||||||||||| |
|
|
| T |
1778564 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccttgcaaatatgcctcatt |
1778663 |
T |
 |
| Q |
224 |
ttggttttggtcc |
236 |
Q |
| |
|
||||||||||||| |
|
|
| T |
1778664 |
ttggttttggtcc |
1778676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 120 - 236
Target Start/End: Complemental strand, 11976740 - 11976624
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcct |
219 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| || |
|
|
| T |
11976740 |
tttaggttaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaaaatttttgttgtttttggtccctgcaaatatgtct |
11976641 |
T |
 |
| Q |
220 |
cattttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
11976640 |
cattttggttttggtcc |
11976624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 119 - 236
Target Start/End: Complemental strand, 2728602 - 2728485
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcc |
218 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||| | |
|
|
| T |
2728602 |
tttttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaatatgtc |
2728503 |
T |
 |
| Q |
219 |
tcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
2728502 |
tcattttggttttggtcc |
2728485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 123 - 236
Target Start/End: Original strand, 34963299 - 34963412
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||| ||||| |
|
|
| T |
34963299 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaaattgttgtttttggtccctgcaaatatgtctcat |
34963398 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
34963399 |
tttggttttggtcc |
34963412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 119 - 236
Target Start/End: Complemental strand, 35097697 - 35097580
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcc |
218 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||| | |
|
|
| T |
35097697 |
tttttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtc |
35097598 |
T |
 |
| Q |
219 |
tcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
35097597 |
tcattttggttttggtcc |
35097580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 124 - 236
Target Start/End: Original strand, 35346629 - 35346741
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcatt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| |||||| |
|
|
| T |
35346629 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctcatt |
35346728 |
T |
 |
| Q |
224 |
ttggttttggtcc |
236 |
Q |
| |
|
||| ||||||||| |
|
|
| T |
35346729 |
ttgattttggtcc |
35346741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 121 - 236
Target Start/End: Original strand, 4473701 - 4473816
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctc |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| || |||||||| |||||||||||||||||| |
|
|
| T |
4473701 |
ttaggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctgcaaaaaaaatttgttgtttttagtccctgcaaatatgcctt |
4473800 |
T |
 |
| Q |
221 |
attttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
4473801 |
attttggttttggtcc |
4473816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 122 - 236
Target Start/End: Original strand, 25600228 - 25600343
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt-nnnnnnnnnttattgtttttggtccctgcaaatatgcctc |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| || ||||||||||||||||||||||||||| |
|
|
| T |
25600228 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctgtaaaaaaatatttgttgtttttggtccctgcaaatatgcctt |
25600327 |
T |
 |
| Q |
221 |
attttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
25600328 |
attttggttttggtcc |
25600343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 124 - 242
Target Start/End: Complemental strand, 4621354 - 4621236
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcatt |
223 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||| || ||||||||||| ||||||||||||||||||| |
|
|
| T |
4621354 |
ggctaaaatatagttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaataatttgttgtttttggttcctgcaaatatgcctcatt |
4621255 |
T |
 |
| Q |
224 |
ttggttttggtcctttgct |
242 |
Q |
| |
|
||| ||||||||| ||||| |
|
|
| T |
4621254 |
ttgattttggtcccttgct |
4621236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 122 - 236
Target Start/End: Original strand, 7326084 - 7326198
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctca |
221 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
7326084 |
taggctaaaatatggttttggtccttgcaaatatgcctcgttttggttttagtccctgcaaaaaaaaattgttgtttttggtccctgcaaatatgtctca |
7326183 |
T |
 |
| Q |
222 |
ttttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
7326184 |
ttttggttttggtcc |
7326198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 122 - 232
Target Start/End: Complemental strand, 32726273 - 32726163
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctca |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
32726273 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaatatgtctca |
32726174 |
T |
 |
| Q |
222 |
ttttggttttg |
232 |
Q |
| |
|
||||||||||| |
|
|
| T |
32726173 |
ttttggttttg |
32726163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 123 - 236
Target Start/End: Complemental strand, 9496724 - 9496611
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||| || |||||||||||||||||||||||| ||||| |
|
|
| T |
9496724 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctcat |
9496625 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
9496624 |
tttggttttggtcc |
9496611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 119 - 236
Target Start/End: Original strand, 42132859 - 42132976
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcc |
218 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || || ||||||||| ||||||||||||| |
|
|
| T |
42132859 |
tttttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaatccctgcaaaaaaaatttgttatttttggtctctgcaaatatgcc |
42132958 |
T |
 |
| Q |
219 |
tcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
42132959 |
tcattttggttttggtcc |
42132976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 120 - 236
Target Start/End: Original strand, 10540445 - 10540561
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcct |
219 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||| ||||||||||||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
10540445 |
tttaggctaaaatattgttttggtctctgcaaatatgcctcgttttggttttagtccctacaatttttttttgttgtttttggtccctgcaaatatgcct |
10540544 |
T |
 |
| Q |
220 |
cattttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
10540545 |
cattttggttttggtcc |
10540561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 124 - 236
Target Start/End: Complemental strand, 37536419 - 37536307
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcatt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||| || |||||||||||||||||||||||| |||||| |
|
|
| T |
37536419 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctcatt |
37536320 |
T |
 |
| Q |
224 |
ttggttttggtcc |
236 |
Q |
| |
|
||||||||||||| |
|
|
| T |
37536319 |
ttggttttggtcc |
37536307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 124 - 236
Target Start/End: Complemental strand, 42430120 - 42430008
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcatt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| || |||||||| ||||||||||||||||||| || |
|
|
| T |
42430120 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccttgtaatttttttttgttgttttttgtccctgcaaatatgcctcgtt |
42430021 |
T |
 |
| Q |
224 |
ttggttttggtcc |
236 |
Q |
| |
|
||||||||||||| |
|
|
| T |
42430020 |
ttggttttggtcc |
42430008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 121 - 236
Target Start/End: Complemental strand, 10337452 - 10337337
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctc |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| || |||||||||||||||||||||||| ||| |
|
|
| T |
10337452 |
ttaggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctgcaaaatttttttgttgtttttggtccctgcaaatatgtctc |
10337353 |
T |
 |
| Q |
221 |
attttggttttggtcc |
236 |
Q |
| |
|
||||| |||||||||| |
|
|
| T |
10337352 |
attttagttttggtcc |
10337337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 118 - 236
Target Start/End: Complemental strand, 9175377 - 9175259
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgc |
217 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||||| |||||||||||||||||| |||| || |||||||||||||||||||||||| |
|
|
| T |
9175377 |
attttaggttaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtctctgtaaattttttttgttgtttttggtccctgcaaatatgt |
9175278 |
T |
 |
| Q |
218 |
ctcattttggttttggtcc |
236 |
Q |
| |
|
||| ||||||||||||||| |
|
|
| T |
9175277 |
ctcgttttggttttggtcc |
9175259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 118 - 236
Target Start/End: Complemental strand, 10873286 - 10873169
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgc |
217 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||| |||||||||||||||||||||| || ||||||||||| ||||||||||||| |
|
|
| T |
10873286 |
atttttggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctgcaaaatttttttgttgtttttggt-cctgcaaatatgc |
10873188 |
T |
 |
| Q |
218 |
ctcattttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
10873187 |
ctcattttggttttggtcc |
10873169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 118 - 236
Target Start/End: Complemental strand, 44998269 - 44998152
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgc |
217 |
Q |
| |
|
||||| |||||||||||||||||| || || |||||||||||||||||||||||||||| ||| || ||||||||||||||||||||||||| |
|
|
| T |
44998269 |
atttttggctaaaatatggttttgatctctacaaatatgtctcgttttggttttagtcc-tgtaaaaaaaaattgttgtttttggtccctgcaaatatgc |
44998171 |
T |
 |
| Q |
218 |
ctcattttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
44998170 |
ctcattttggttttggtcc |
44998152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 119 - 212
Target Start/End: Original strand, 10337114 - 10337207
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
10337114 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
10337207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 123 - 242
Target Start/End: Complemental strand, 28324182 - 28324064
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| || || |||||||||||| |||||||| ||||| |
|
|
| T |
28324182 |
aggctaaaatatggttttggtccctacaaatatgtcttgttttggttttagtccctgt-aaaaaaaattgttatttttggtccctacaaatatgtctcat |
28324084 |
T |
 |
| Q |
223 |
tttggttttggtcctttgct |
242 |
Q |
| |
|
|||||||||||||| ||||| |
|
|
| T |
28324083 |
tttggttttggtcccttgct |
28324064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 123 - 212
Target Start/End: Complemental strand, 8298976 - 8298887
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
8298976 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
8298887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 123 - 236
Target Start/End: Original strand, 20277691 - 20277804
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| |||||||||||||| | |||||||| |||||||||||||||| || | |
|
|
| T |
20277691 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctgtaatttttttgttttgtttttagtccctgcaaatatgcttcgt |
20277790 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
20277791 |
tttggttttggtcc |
20277804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 123 - 236
Target Start/End: Original strand, 21064318 - 21064431
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| |||||||||||||| | |||||||| |||||||||||||||| || | |
|
|
| T |
21064318 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctgtaatttttttgttttgtttttagtccctgcaaatatgcttcgt |
21064417 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
21064418 |
tttggttttggtcc |
21064431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 119 - 212
Target Start/End: Complemental strand, 42133159 - 42133066
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
42133159 |
tttttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
42133066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 118 - 179
Target Start/End: Complemental strand, 11019863 - 11019802
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
11019863 |
attttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
11019802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 119 - 180
Target Start/End: Complemental strand, 14489078 - 14489017
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14489078 |
tttttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
14489017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 124 - 212
Target Start/End: Complemental strand, 34963664 - 34963576
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34963664 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttattgtttttggtccctgcaaa |
34963576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 122 - 179
Target Start/End: Original strand, 35097326 - 35097383
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35097326 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35097383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 122 - 179
Target Start/End: Complemental strand, 35347000 - 35346943
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35347000 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35346943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 124 - 180
Target Start/End: Complemental strand, 7186004 - 7185948
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7186004 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
7185948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 123 - 179
Target Start/End: Original strand, 32725906 - 32725962
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32725906 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
32725962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 125 - 236
Target Start/End: Complemental strand, 13779531 - 13779423
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattt |
224 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||||||||||||||| |||||| || |||||||||||||||||||||||| ||| ||| |
|
|
| T |
13779531 |
gctaaaatatggatttggtccctgcaaatatgcctcgttttggttttagcccctgt---aatttttttttgtttttggtccctgcaaatatgtctcgttt |
13779435 |
T |
 |
| Q |
225 |
tggttttggtcc |
236 |
Q |
| |
|
|||||||||||| |
|
|
| T |
13779434 |
tggttttggtcc |
13779423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 123 - 213
Target Start/End: Complemental strand, 24815069 - 24814979
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaat |
213 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
24815069 |
aggctaaaatatggttttggcccctgcaaatatgtctcattttggttttagtccctgtaaaaaaaaattattgtttttggtccctgcaaat |
24814979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 121 - 179
Target Start/End: Complemental strand, 4710223 - 4710165
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4710223 |
ttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
4710165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 122 - 180
Target Start/End: Original strand, 17073805 - 17073863
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
17073805 |
taggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt |
17073863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 122 - 180
Target Start/End: Complemental strand, 17574465 - 17574407
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
17574465 |
taggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt |
17574407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 131 - 244
Target Start/End: Original strand, 23360378 - 23360491
Alignment:
| Q |
131 |
atatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattttggttt |
230 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||||||||| ||| |||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
23360378 |
atatggttttggtctctgcaaatatgtctcgttttaattttagtccatgtaaaactattttatagtttttggtccctgcaaatatgccttgttttggttt |
23360477 |
T |
 |
| Q |
231 |
tggtcctttgcttc |
244 |
Q |
| |
|
|||||||| ||||| |
|
|
| T |
23360478 |
tggtccttggcttc |
23360491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 118 - 180
Target Start/End: Original strand, 27117747 - 27117809
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
27117747 |
attttaggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctgt |
27117809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 122 - 180
Target Start/End: Original strand, 29158352 - 29158410
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29158352 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
29158410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 118 - 179
Target Start/End: Original strand, 3511900 - 3511961
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
3511900 |
attttaggctaaaatatggttttggtcccttcaaatatgcctcgttttggttttagtccctg |
3511961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 122 - 179
Target Start/End: Original strand, 9496339 - 9496396
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9496339 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
9496396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 11976372 - 11976429
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11976372 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
11976429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 14238750 - 14238807
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14238750 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
14238807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 20984511 - 20984454
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
20984511 |
aggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctgt |
20984454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 115 - 180
Target Start/End: Complemental strand, 33526421 - 33526356
Alignment:
| Q |
115 |
atgattttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33526421 |
atgattttaggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt |
33526356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 123 - 179
Target Start/End: Original strand, 2728231 - 2728287
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2728231 |
aggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtccctg |
2728287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 125 - 236
Target Start/End: Complemental strand, 5357762 - 5357651
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattt |
224 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||||||||| ||| || ||||||||||||||||||||||||| |||||| |
|
|
| T |
5357762 |
gctaaaatatgattttggtccctgcaaatatgcttcgttttggttttagtctttgtaatttttttttgttgtttttggtccctgcaaatatgcttcattt |
5357663 |
T |
 |
| Q |
225 |
tggttttggtcc |
236 |
Q |
| |
|
| |||||||||| |
|
|
| T |
5357662 |
tagttttggtcc |
5357651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 124 - 180
Target Start/End: Complemental strand, 7326421 - 7326365
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7326421 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
7326365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 123 - 179
Target Start/End: Original strand, 28346393 - 28346449
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
28346393 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
28346449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 123 - 179
Target Start/End: Original strand, 37536085 - 37536141
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
37536085 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
37536141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 122 - 236
Target Start/End: Original strand, 13154884 - 13154998
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctca |
221 |
Q |
| |
|
||||||||||||| |||||| ||| |||||||||| ||||||||||||||||||||||| || |||||||||||||||||||||||| || |
|
|
| T |
13154884 |
taggctaaaatatagttttgatccttgcaaatatgcctcgttttggttttagtccctgtaattttcttttgttgtttttggtccctgcaaatatgtttcg |
13154983 |
T |
 |
| Q |
222 |
ttttggttttggtcc |
236 |
Q |
| |
|
||||| ||||||||| |
|
|
| T |
13154984 |
ttttgattttggtcc |
13154998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 119 - 178
Target Start/End: Complemental strand, 24955015 - 24954956
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24955015 |
ttttaggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccct |
24954956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 147 - 236
Target Start/End: Original strand, 4709929 - 4710018
Alignment:
| Q |
147 |
tgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4709929 |
tgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaatatgtctcattttggttttggtcc |
4710018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 123 - 212
Target Start/End: Complemental strand, 7420591 - 7420502
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
7420591 |
aggctaaaatatggttttggtcactgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
7420502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 126 - 180
Target Start/End: Complemental strand, 18549571 - 18549517
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18549571 |
ctaaaatatggttttcgtccctgcaaatatgtctcgttttggttttagtccctgt |
18549517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 122 - 180
Target Start/End: Original strand, 40492958 - 40493016
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
40492958 |
taggctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagtccctgt |
40493016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 122 - 179
Target Start/End: Complemental strand, 1526174 - 1526117
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1526174 |
taggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctg |
1526117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 4474045 - 4473988
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4474045 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctgt |
4473988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 7272419 - 7272476
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7272419 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtctctgt |
7272476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 122 - 179
Target Start/End: Original strand, 8094477 - 8094534
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
8094477 |
taggctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagtccctg |
8094534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 9175011 - 9175068
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
9175011 |
aggctaaaatatgattttggtccttgcaaatatgtctcgttttggttttagtccctgt |
9175068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 10540783 - 10540726
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
10540783 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgt |
10540726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 10872914 - 10872971
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10872914 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctgt |
10872971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 120 - 212
Target Start/End: Complemental strand, 13155255 - 13155163
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||||||| ||||||| |||||||||||| |||||||||| |
|
|
| T |
13155255 |
tttaggctaaaatatggtttttgttcctgcaaatatgtctcgttttggttttaatccctgtaaaaaaaaattattgtttttgatccctgcaaa |
13155163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 14239081 - 14239024
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14239081 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
14239024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 118 - 179
Target Start/End: Complemental strand, 16644050 - 16643989
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
16644050 |
atttaaggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctg |
16643989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 16789074 - 16789131
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
16789074 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgt |
16789131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 122 - 179
Target Start/End: Original strand, 19494117 - 19494174
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
19494117 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
19494174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 22650463 - 22650520
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
22650463 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt |
22650520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 124 - 236
Target Start/End: Original strand, 23939547 - 23939659
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcatt |
223 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| |||||||| ||| | || ||||||||||||||||||||||| ||| || |
|
|
| T |
23939547 |
ggctaaaatatggttttggtcactgcaaatatgtctcgttttagttttagttcctataattttttttttttgtttttggtccctgcaaatatatctcgtt |
23939646 |
T |
 |
| Q |
224 |
ttggttttggtcc |
236 |
Q |
| |
|
|||||||| |||| |
|
|
| T |
23939647 |
ttggttttagtcc |
23939659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 25131110 - 25131167
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
25131110 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgt |
25131167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 25600598 - 25600541
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
25600598 |
aggctaaaatatagttttggtccctgcaaatatgtcttgttttggttttagtccctgt |
25600541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 27341592 - 27341535
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27341592 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
27341535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 236
Target Start/End: Original strand, 28497254 - 28497366
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |||||||| |||||||||| ||| || |||||||||||||||||||||||| || | |
|
|
| T |
28497254 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttagttttagtccatgt-aattttttttgttgtttttggtccctgcaaatatgaatcgt |
28497352 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
28497353 |
tttggttttggtcc |
28497366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 43477162 - 43477219
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43477162 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
43477219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 122 - 178
Target Start/End: Original strand, 5357421 - 5357477
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5357421 |
taggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccct |
5357477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 124 - 180
Target Start/End: Complemental strand, 16789369 - 16789313
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16789369 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
16789313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 19494414 - 19494358
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
19494414 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
19494358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 120 - 176
Target Start/End: Complemental strand, 20278061 - 20278005
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
20278061 |
tttaggctaaaatatggttttggtccctgcagatatgcctcgttttggttttagtcc |
20278005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 120 - 176
Target Start/End: Complemental strand, 21064688 - 21064632
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
21064688 |
tttaggctaaaatatggttttggtccctgcagatatgcctcgttttggttttagtcc |
21064632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 123 - 179
Target Start/End: Original strand, 22917563 - 22917619
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
22917563 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
22917619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 24187898 - 24187842
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24187898 |
aggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtccctg |
24187842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 120 - 179
Target Start/End: Original strand, 16643657 - 16643716
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
16643657 |
tttaggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
16643716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 125 - 180
Target Start/End: Complemental strand, 24090487 - 24090432
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
24090487 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtctctgt |
24090432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 126 - 180
Target Start/End: Original strand, 13779151 - 13779205
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
13779151 |
ctaaaatatggttttgatccctgcaaatatgtctcgttttggttttattccctgt |
13779205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 118 - 180
Target Start/End: Complemental strand, 35345623 - 35345561
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
35345623 |
attttaggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttaatccctgt |
35345561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 121 - 236
Target Start/End: Complemental strand, 6469670 - 6469554
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt-nnnnnnnnnttattgtttttggtccctgcaaatatgcct |
219 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||| ||||||||||||||||||||| || ||||||||| ||| ||||||||| || |
|
|
| T |
6469670 |
ttaggctaaaatatgattttggtcactgcaaatatgttacgttttggttttagtccctgtaattttattttttttgtttttgatccatgcaaatatatct |
6469571 |
T |
 |
| Q |
220 |
cattttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
6469570 |
cattttggttttggtcc |
6469554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 124 - 212
Target Start/End: Complemental strand, 7272751 - 7272663
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
||||||||||||||||| | ||||||||||||| ||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
7272751 |
ggctaaaatatggttttagcccctgcaaatatgcctcgttttggttttagtccctgtaaacaaaattttttgtttttggtccctgcaaa |
7272663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 14495068 - 14495125
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
14495068 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt |
14495125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 124 - 177
Target Start/End: Original strand, 15719656 - 15719709
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
177 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
15719656 |
ggctaaaatatggttttagtccctgcaaatatatctcgttttggttttagtccc |
15719709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 119 - 180
Target Start/End: Original strand, 15930927 - 15930988
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||| ||||||||||| ||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
15930927 |
ttttatgctaaaatatgattttggttcctacaaatatgtctcgttttggttttagtccctgt |
15930988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 119 - 180
Target Start/End: Original strand, 25702507 - 25702568
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |||||||| ||||||||||||| |
|
|
| T |
25702507 |
ttttaggctaaaatatggttttggtccctgtaaatatgcctcgttttaattttagtccctgt |
25702568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 127 - 180
Target Start/End: Complemental strand, 28497616 - 28497563
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28497616 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgt |
28497563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 29488111 - 29488054
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29488111 |
aggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgt |
29488054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 122 - 236
Target Start/End: Complemental strand, 29992302 - 29992189
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt-nnnnnnnnnttattgtttttggtccctgcaaatatgcctc |
220 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||| ||||||||| ||||||||||||| || ||||||||||||||||||| ||| ||| |
|
|
| T |
29992302 |
taggctcaaatatggttttgttccctgcaaatatgcctcgttttgattttagtccctgtaaaaaaaaaattgttgtttttggtccctgcaa--atgtctc |
29992205 |
T |
 |
| Q |
221 |
attttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
29992204 |
attttggttttggtcc |
29992189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 119 - 180
Target Start/End: Original strand, 30969393 - 30969454
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||| ||||||||||||||||||||| | ||||||||| |||||||||||||||||||||| |
|
|
| T |
30969393 |
ttttatgctaaaatatggttttggtccttacaaatatgtttcgttttggttttagtccctgt |
30969454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 119 - 180
Target Start/End: Original strand, 32040070 - 32040131
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| | || |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32040070 |
ttttaggctaaaatatgatcttagtccctgcaaatatgtttcgttttggttttagtccctgt |
32040131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 176
Target Start/End: Original strand, 32418317 - 32418370
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32418317 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
32418370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 127 - 180
Target Start/End: Complemental strand, 40844532 - 40844479
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40844532 |
taaaatatggttttagtccctgcaaatatatctcgttttggttttagtccctgt |
40844479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 123 - 175
Target Start/End: Original strand, 1525808 - 1525860
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
175 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
1525808 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
1525860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 127 - 175
Target Start/End: Complemental strand, 2811778 - 2811730
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
175 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2811778 |
taaaatatggttttgatccctgcaaatatgtctcgttttggttttagtc |
2811730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 4017301 - 4017245
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
4017301 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
4017245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 124 - 180
Target Start/End: Original strand, 4375692 - 4375748
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
4375692 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctgt |
4375748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 121 - 212
Target Start/End: Original strand, 6469277 - 6469368
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||| ||||||||||||||||| ||||| || |||||||||||||||||||| |
|
|
| T |
6469277 |
ttaggctaaaatatggctttcgtccctgcaaatatgcctcgttttggttttagttcctgtaaaaaaaaattgttgtttttggtccctgcaaa |
6469368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 124 - 180
Target Start/End: Complemental strand, 10776499 - 10776443
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
10776499 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt |
10776443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 123 - 179
Target Start/End: Original strand, 38930301 - 38930357
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
38930301 |
aggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagttcctg |
38930357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 124 - 180
Target Start/End: Complemental strand, 40066820 - 40066764
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
40066820 |
ggctaaaatatggttttagtccctgcaaatatgccccgttttggttttagtccctgt |
40066764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 124 - 180
Target Start/End: Original strand, 40844156 - 40844212
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40844156 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgt |
40844212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 129 - 180
Target Start/End: Original strand, 3680532 - 3680583
Alignment:
| Q |
129 |
aaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3680532 |
aaatatggttttgctccctgcaaatatgactcgttttggttttagtccctgt |
3680583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 125 - 180
Target Start/End: Complemental strand, 6146948 - 6146893
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6146948 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgt |
6146893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 122 - 177
Target Start/End: Complemental strand, 8094843 - 8094788
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
177 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||| |||||||||||||||||||| |
|
|
| T |
8094843 |
taggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccc |
8094788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 27117977 - 27117922
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||| |||||| |
|
|
| T |
27117977 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttggtccct |
27117922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 122 - 177
Target Start/End: Original strand, 33636320 - 33636375
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
177 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
33636320 |
taggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccc |
33636375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 125 - 172
Target Start/End: Complemental strand, 36044791 - 36044744
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
172 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
36044791 |
gctaaaatatggttttggtccctgcaaatgtgtctcgttttggtttta |
36044744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 125 - 179
Target Start/End: Original strand, 4016906 - 4016960
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
4016906 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctg |
4016960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 126 - 172
Target Start/End: Original strand, 10776150 - 10776196
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
172 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10776150 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
10776196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 124 - 174
Target Start/End: Complemental strand, 13232562 - 13232512
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
13232562 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagt |
13232512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 127 - 212
Target Start/End: Complemental strand, 13796593 - 13796508
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
||||||||||||| | |||||||||||||||||| ||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
13796593 |
taaaatatggtttggatccctgcaaatatgtctcattttggttttagtccctgtaaattttttttgttgtttttggtccctgcaaa |
13796508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 127 - 236
Target Start/End: Original strand, 14847828 - 14847937
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattttg |
226 |
Q |
| |
|
||||||||| ||||| |||||||||||||| ||| ||||||||||||||||| | || ||||||||| |||||||||||||| ||| ||||| |
|
|
| T |
14847828 |
taaaatatgattttgatccctgcaaatatgcctcattttggttttagtccctataatttttttttgttgtttttgatccctgcaaatatgtctcgttttg |
14847927 |
T |
 |
| Q |
227 |
gttttggtcc |
236 |
Q |
| |
|
||||||||| |
|
|
| T |
14847928 |
attttggtcc |
14847937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 127 - 236
Target Start/End: Original strand, 17574105 - 17574214
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattttg |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |||||||| || | || ||||||||||||||| |||||||||||| ||||| |
|
|
| T |
17574105 |
taaaatatggttttggtccctgcaaatatgtcgggttttgattttagtctctataaattttttttgttgtttttggtccctacaaatatgcctcgttttg |
17574204 |
T |
 |
| Q |
227 |
gttttggtcc |
236 |
Q |
| |
|
|||| |||| |
|
|
| T |
17574205 |
attttagtcc |
17574214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 122 - 180
Target Start/End: Original strand, 18549199 - 18549257
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
18549199 |
taggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtctctgt |
18549257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 122 - 180
Target Start/End: Original strand, 19962993 - 19963051
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||| || |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
19962993 |
taggctaaaatatggtgttagtccttgcaaatatgtctcgttttagttttagtccctgt |
19963051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 123 - 236
Target Start/End: Original strand, 24090118 - 24090231
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
||||||||||||||||||||| | || | ||||||||||||||| ||||||||||| | || ||||||||||| |||||||||||| ||| | |
|
|
| T |
24090118 |
aggctaaaatatggttttggttcttgtagatatgtctcgttttgattttagtccctataattttttgttgttgtttttggttcctgcaaatatgtctcgt |
24090217 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
||||||||| |||| |
|
|
| T |
24090218 |
tttggttttcgtcc |
24090231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 124 - 178
Target Start/End: Complemental strand, 25131447 - 25131393
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||||||||||||||||||||| |
|
|
| T |
25131447 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccct |
25131393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 122 - 180
Target Start/End: Complemental strand, 28399037 - 28398979
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
28399037 |
taggctaaaatatgattttagtccctgcaaatatggttcgttttggttttagtccctgt |
28398979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 127 - 176
Target Start/End: Original strand, 1685117 - 1685166
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
1685117 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
1685166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 128 - 236
Target Start/End: Complemental strand, 17074164 - 17074056
Alignment:
| Q |
128 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattttgg |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |||||||| || | || ||||||||||||||| |||||||||||| ||||| |
|
|
| T |
17074164 |
aaaatatggttttggtccctgcaaatatgtcgggttttgattttagtctctataaattttttttgttgtttttggtccctacaaatatgcctcgttttga |
17074065 |
T |
 |
| Q |
228 |
ttttggtcc |
236 |
Q |
| |
|
|||| |||| |
|
|
| T |
17074064 |
ttttagtcc |
17074056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 21125718 - 21125775
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
21125718 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttaatccctgt |
21125775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 24187568 - 24187625
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
24187568 |
aggctaaaatatggttttaatccctgcaaatatgcttcgttttggttttagtccctgt |
24187625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 40066496 - 40066553
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||| |||||||| ||||| |
|
|
| T |
40066496 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagttcctgt |
40066553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 136 - 180
Target Start/End: Complemental strand, 1778917 - 1778873
Alignment:
| Q |
136 |
gttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1778917 |
gttttggtccctgcaaatatgtctcgttttggttttaatccctgt |
1778873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 3680802 - 3680746
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
3680802 |
aggctaaaatatgattttgatccctgcaaatatgcctcgttttggttttggtccctg |
3680746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #142
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 28323843 - 28323903
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
|||| |||||||||||||||| | ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28323843 |
atttaaggctaaaatatggttgtagtccctgcaaatatgcttcgttttggttttagtccct |
28323903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #143
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 124 - 176
Target Start/End: Complemental strand, 29158669 - 29158617
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
29158669 |
ggctaaaatatggttttaatccctgcaaatatatctcgttttggttttagtcc |
29158617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #144
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 124 - 176
Target Start/End: Original strand, 29487750 - 29487802
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
29487750 |
ggctaaaatatgattttcgtccctgcaaatatgtttcgttttggttttagtcc |
29487802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #145
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 38930665 - 38930609
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
38930665 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttaatccctg |
38930609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #146
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 124 - 179
Target Start/End: Original strand, 1162909 - 1162964
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
1162909 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtccctg |
1162964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #147
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 1408354 - 1408299
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| |||| |||||||||||| |
|
|
| T |
1408354 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtccct |
1408299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #148
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 125 - 176
Target Start/End: Original strand, 6146517 - 6146568
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||||||||| |
|
|
| T |
6146517 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtcc |
6146568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #149
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 14496815 - 14496870
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| |||||||||||||||||||| |
|
|
| T |
14496815 |
aggctaaaatatggttttagttcctgcaaatatgcgtcgttttggttttagtccct |
14496870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #150
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 121 - 180
Target Start/End: Complemental strand, 21126024 - 21125965
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||| ||||| |||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
21126024 |
ttaggctaaaatatagttttagtccatgtaaatatgactcgttttggttttagtccctgt |
21125965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #151
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 129 - 176
Target Start/End: Original strand, 24814710 - 24814757
Alignment:
| Q |
129 |
aaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
24814710 |
aaatatggttttggtccctgcaaatatgcctcattttggttttagtcc |
24814757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #152
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 122 - 165
Target Start/End: Complemental strand, 25702811 - 25702768
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgtttt |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25702811 |
taggctaaaatatggttttggtccctgcaaatatgtctcatttt |
25702768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #153
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 27117963 - 27117924
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27117963 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
27117924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #154
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 123 - 170
Target Start/End: Complemental strand, 30337218 - 30337171
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
170 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
30337218 |
aggctaaaatatagttttagtccctgcaaatatgtctcgttttggttt |
30337171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #155
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 124 - 178
Target Start/End: Complemental strand, 10755528 - 10755474
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||| ||||| ||||| |
|
|
| T |
10755528 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttaatccct |
10755474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #156
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 23939620 - 23939662
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23939620 |
ttttggtccctgcaaatatatctcgttttggttttagtccctg |
23939662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #157
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 197 - 239
Target Start/End: Original strand, 24814718 - 24814760
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtccttt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
24814718 |
ttttggtccctgcaaatatgcctcattttggttttagtccttt |
24814760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #158
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 122 - 176
Target Start/End: Complemental strand, 28258243 - 28258189
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
28258243 |
taggctaaaatatggttttaacctctgcaaatatgtctcgttttggttttagtcc |
28258189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #159
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 123 - 212
Target Start/End: Original strand, 42429757 - 42429845
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||| |||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
42429757 |
aggctaaaatatggttttggtccctacaaatatgcctc-atttggttttagtccctgtaatttttttttgttgtttttggtccctgcaaa |
42429845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #160
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 126 - 176
Target Start/End: Complemental strand, 43727431 - 43727382
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
43727431 |
ctaaaatatggttttagtcc-tgcaaatatgtctcgttttggttttagtcc |
43727382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #161
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 123 - 212
Target Start/End: Original strand, 44997930 - 44998019
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||||||| ||||| | ||||| || |||||||||||||||||||| |
|
|
| T |
44997930 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttgattttaattcctgtaaattttttttgttgtttttggtccctgcaaa |
44998019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #162
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 124 - 173
Target Start/End: Original strand, 1408005 - 1408054
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttag |
173 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||| ||||||| |
|
|
| T |
1408005 |
ggctaaaatatggttttagtccatgcaaatatgtctcgttttagttttag |
1408054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #163
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 9832214 - 9832271
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||| | |||||||||||| ||||||| |
|
|
| T |
9832214 |
aggctaaattatggttttggtccttgcaaatatgttttgttttggttttaatccctgt |
9832271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #164
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 14488715 - 14488772
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||| ||||| ||||||| ||||||| |||||||||||||||||| |||| |
|
|
| T |
14488715 |
aggctaaaatatagttttagtccctgaaaatatgcctcgttttggttttagtctctgt |
14488772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #165
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 125 - 177
Target Start/End: Complemental strand, 14495389 - 14495337
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
177 |
Q |
| |
|
||||||||||||| || ||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
14495389 |
gctaaaatatggtnttagtccccgcaaatatgcctcgttttggttttagtccc |
14495337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #166
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 127 - 180
Target Start/End: Original strand, 29991918 - 29991971
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||| ||||||||| |||| |
|
|
| T |
29991918 |
taaaatatggttttggtctctgcaaatatgcctcgttttagttttagtctctgt |
29991971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #167
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 122 - 179
Target Start/End: Complemental strand, 35115641 - 35115584
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||| |||||||||||||| ||||||| |
|
|
| T |
35115641 |
taggctaaaatatggttttagtccctacaaatatacctcgttttggttttggtccctg |
35115584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #168
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 122 - 179
Target Start/End: Complemental strand, 35143846 - 35143789
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||| ||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
35143846 |
taggctaaaatatggttttaatccgtgtaaatatgcctcgttttggttttagtccctg |
35143789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #169
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 124 - 176
Target Start/End: Original strand, 33526052 - 33526104
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
33526052 |
ggctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagtcc |
33526104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #170
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 36044430 - 36044490
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||||||| |||||||| ||||||||||| |
|
|
| T |
36044430 |
attttaggctaaaatatggtttaggtccctacaaatatttctcgtttcaattttagtccct |
36044490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #171
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 121 - 180
Target Start/End: Complemental strand, 2356251 - 2356192
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||| ||||||||| ||||| | | ||||||||||||||||||||||||||||| |||| |
|
|
| T |
2356251 |
ttaggttaaaatatgattttgattcatgcaaatatgtctcgttttggttttagtctctgt |
2356192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #172
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 120 - 175
Target Start/End: Complemental strand, 4376014 - 4375960
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
175 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| ||| ||||||||||||| |
|
|
| T |
4376014 |
tttaggctaaaatatggttttagtccctgcaaatatgcttcg-tttggttttagtc |
4375960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #173
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 124 - 175
Target Start/End: Original strand, 32195280 - 32195331
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
175 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |||| |||||||| |
|
|
| T |
32195280 |
ggctaaaatatggttttggtccctacaaatatgtctcattttaattttagtc |
32195331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #174
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 2728524 - 2728482
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
2728524 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
2728482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #175
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 3512193 - 3512151
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
3512193 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
3512151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #176
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 4709979 - 4710021
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
4709979 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
4710021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #177
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 7326159 - 7326201
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
7326159 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
7326201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #178
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 9496650 - 9496608
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
9496650 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
9496608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #179
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 11019593 - 11019635
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
11019593 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
11019635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #180
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 11976663 - 11976621
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
11976663 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
11976621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #181
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 197 - 231
Target Start/End: Complemental strand, 13232549 - 13232515
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggtttt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
13232549 |
ttttggtccctgcaaatatgcctcattttggtttt |
13232515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #182
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 20984219 - 20984261
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
20984219 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
20984261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #183
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 28346685 - 28346643
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
28346685 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
28346643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #184
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 34963373 - 34963415
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
34963373 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
34963415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #185
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 35097619 - 35097577
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
35097619 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
35097577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #186
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 37536346 - 37536304
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
37536346 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
37536304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #187
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 123 - 234
Target Start/End: Original strand, 2355886 - 2355995
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
|||||||||||| | |||| ||||||||||||| || |||||||||||||||||| | | |||||||||||||||||||||||| || | |
|
|
| T |
2355886 |
aggctaaaatataggtttgatccctgcaaatataccttgttttggttttagtccctctaatttttgtt--ttgtttttggtccctgcaaatatgtttcgt |
2355983 |
T |
 |
| Q |
223 |
tttggttttggt |
234 |
Q |
| |
|
|||||||||||| |
|
|
| T |
2355984 |
tttggttttggt |
2355995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #188
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 118 - 155
Target Start/End: Original strand, 10717115 - 10717152
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatat |
155 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10717115 |
attttaggctaaaatatgcttttggtccctgcaaatat |
10717152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #189
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 127 - 176
Target Start/End: Complemental strand, 23939907 - 23939858
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||||||| | |||||||||||| |||||||||| |||||||| |
|
|
| T |
23939907 |
taaaatatggttttgattcctgcaaatatgactcgttttggctttagtcc |
23939858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #190
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 137 - 178
Target Start/End: Original strand, 24090192 - 24090233
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
24090192 |
ttttggttcctgcaaatatgtctcgttttggttttcgtccct |
24090233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #191
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 124 - 169
Target Start/End: Complemental strand, 40493157 - 40493112
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtt |
169 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
40493157 |
ggctaaaatgtggttttagtccctgcaaatatgcctcgttttggtt |
40493112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #192
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 197 - 238
Target Start/End: Complemental strand, 42430107 - 42430066
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcctt |
238 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
42430107 |
ttttggtccctgcaaatatgtctcattttggttttagtcctt |
42430066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #193
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 119 - 175
Target Start/End: Complemental strand, 1163279 - 1163223
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
175 |
Q |
| |
|
|||| ||||||||||||||||| |||| |||||||||| | |||||| ||||||||| |
|
|
| T |
1163279 |
tttttggctaaaatatggttttagtccatgcaaatatgccccgttttagttttagtc |
1163223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #194
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 145 - 177
Target Start/End: Complemental strand, 14848169 - 14848137
Alignment:
| Q |
145 |
cctgcaaatatgtctcgttttggttttagtccc |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
14848169 |
cctgcaaatatgtctcgttttggttttagtccc |
14848137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #195
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 124 - 156
Target Start/End: Complemental strand, 30969717 - 30969685
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatg |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
30969717 |
ggctaaaatatggttttggtccctgcaaatatg |
30969685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #196
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 123 - 175
Target Start/End: Complemental strand, 31445464 - 31445412
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
175 |
Q |
| |
|
|||||||||||| |||||| ||||| |||||||| ||| |||||||||||||| |
|
|
| T |
31445464 |
aggctaaaatatagttttgatccctacaaatatgcctcattttggttttagtc |
31445412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #197
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 124 - 179
Target Start/End: Complemental strand, 3031602 - 3031547
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||| ||| ||| |||||| ||||||| |
|
|
| T |
3031602 |
ggctaaaatatgtttttggtccctgtaaatatggctcatttaggttttggtccctg |
3031547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #198
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 3680788 - 3680749
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
3680788 |
ttttgatccctgcaaatatgcctcgttttggttttggtcc |
3680749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #199
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 4710207 - 4710168
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
4710207 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
4710168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #200
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Original strand, 5357436 - 5357475
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
5357436 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
5357475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #201
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 7326408 - 7326369
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
7326408 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
7326369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #202
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 11019844 - 11019805
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
11019844 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
11019805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #203
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Original strand, 11976386 - 11976425
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
11976386 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
11976425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #204
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Original strand, 17073820 - 17073859
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
17073820 |
ttttggtccctgcaaatatgtctcattttggttttagtcc |
17073859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #205
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 17574450 - 17574411
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
17574450 |
ttttggtccctgcaaatatgtctcattttggttttagtcc |
17574411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #206
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Original strand, 28346407 - 28346446
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
28346407 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
28346446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #207
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 28497606 - 28497567
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
28497606 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
28497567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #208
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 32726258 - 32726219
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
32726258 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
32726219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #209
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 127 - 174
Target Start/End: Original strand, 33652193 - 33652240
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
174 |
Q |
| |
|
||||||||| |||| ||||||||||||||| |||||||| |||||||| |
|
|
| T |
33652193 |
taaaatatgattttagtccctgcaaatatgcctcgttttagttttagt |
33652240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #210
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Original strand, 37536099 - 37536138
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
37536099 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
37536138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #211
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 194 - 236
Target Start/End: Complemental strand, 3031592 - 3031550
Alignment:
| Q |
194 |
tgtttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||| ||||||| ||||||| ||||||||||| |
|
|
| T |
3031592 |
tgtttttggtccctgtaaatatggctcatttaggttttggtcc |
3031550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #212
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 8298660 - 8298702
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||||| |
|
|
| T |
8298660 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
8298702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #213
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 124 - 166
Target Start/End: Original strand, 9908918 - 9908960
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttg |
166 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
9908918 |
ggctaaaatatagttttaatccctgcaaatatgtctcgttttg |
9908960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #214
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 10337376 - 10337334
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||| ||||||| |
|
|
| T |
10337376 |
ttttggtccctgcaaatatgtctcattttagttttggtccctg |
10337334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #215
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 10540522 - 10540564
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||||| |
|
|
| T |
10540522 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
10540564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #216
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 13154959 - 13155001
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||||| |||||||| |||| ||||||| |
|
|
| T |
13154959 |
ttttggtccctgcaaatatgtttcgttttgattttggtccctg |
13155001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #217
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 13796280 - 13796321
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
13796280 |
ttttggtccctgcaaatatgtct-gttttggttttggtccctg |
13796321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #218
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 17074095 - 17074053
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||| |||||||| ||||||||| |||||||||||| |
|
|
| T |
17074095 |
ttttggtccctacaaatatgcctcgttttgattttagtccctg |
17074053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #219
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 17574175 - 17574217
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||| |||||||| ||||||||| |||||||||||| |
|
|
| T |
17574175 |
ttttggtccctacaaatatgcctcgttttgattttagtccctg |
17574217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #220
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 197 - 231
Target Start/End: Complemental strand, 24090475 - 24090441
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggtttt |
231 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
24090475 |
ttttggtccctgcaaatatgcctcgttttggtttt |
24090441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #221
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 28497327 - 28497369
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
28497327 |
ttttggtccctgcaaatatgaatcgttttggttttggtccctg |
28497369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #222
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 120 - 154
Target Start/End: Complemental strand, 30124286 - 30124252
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaata |
154 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |
|
|
| T |
30124286 |
tttaggctaaaatatgcttttggtccctgcaaata |
30124252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #223
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 35346702 - 35346744
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||| ||||||| |
|
|
| T |
35346702 |
ttttggtccctgcaaatatgtctcattttgattttggtccctg |
35346744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #224
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 42430047 - 42430005
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
42430047 |
tttttgtccctgcaaatatgcctcgttttggttttggtccctg |
42430005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #225
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 126 - 180
Target Start/End: Original strand, 43727097 - 43727151
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||| ||||||||||||||| | |||||| ||||||| ||||| |
|
|
| T |
43727097 |
ctaaaatatggttttagtccctgcaaatatgcattgttttgattttagttcctgt |
43727151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #226
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 44998191 - 44998149
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||||| |
|
|
| T |
44998191 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
44998149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #227
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 122 - 155
Target Start/End: Complemental strand, 1385616 - 1385583
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatat |
155 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |
|
|
| T |
1385616 |
taggcttaaatatggttttggtccctgcaaatat |
1385583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #228
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 197 - 238
Target Start/End: Original strand, 1685127 - 1685168
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcctt |
238 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
1685127 |
ttttagtccctgcaaatatgcctcgttttggttttagtcctt |
1685168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #229
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 118 - 155
Target Start/End: Original strand, 3483627 - 3483664
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatat |
155 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
3483627 |
attttagactaaaatatgtttttggtccctgcaaatat |
3483664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #230
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 122 - 155
Target Start/End: Complemental strand, 10718509 - 10718476
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatat |
155 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
10718509 |
taggctaaaatatgcttttggtccctgcaaatat |
10718476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #231
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 123 - 156
Target Start/End: Original strand, 14197824 - 14197857
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatg |
156 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
14197824 |
aggctaaaatatgtttttggtccctgcaaatatg |
14197857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #232
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 137 - 178
Target Start/End: Original strand, 14847898 - 14847939
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
||||| |||||||||||||||||||||||| |||| |||||| |
|
|
| T |
14847898 |
ttttgatccctgcaaatatgtctcgttttgattttggtccct |
14847939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #233
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 197 - 238
Target Start/End: Complemental strand, 20278044 - 20278003
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcctt |
238 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||| |||||| |
|
|
| T |
20278044 |
ttttggtccctgcagatatgcctcgttttggttttagtcctt |
20278003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #234
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 197 - 238
Target Start/End: Complemental strand, 21064671 - 21064630
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcctt |
238 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||| |||||| |
|
|
| T |
21064671 |
ttttggtccctgcagatatgcctcgttttggttttagtcctt |
21064630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #235
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 119 - 156
Target Start/End: Complemental strand, 21509923 - 21509886
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatg |
156 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
21509923 |
ttttaggctaaaatatgattttagtccctgcaaatatg |
21509886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #236
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 26530667 - 26530724
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||| |||||||||||| |||| |||||||||| ||| |||| |||||||| ||||| |
|
|
| T |
26530667 |
aggcttaaatatggttttagtccatgcaaatatgcctcattttagttttagttcctgt |
26530724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #237
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 197 - 238
Target Start/End: Original strand, 32418331 - 32418372
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcctt |
238 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
32418331 |
ttttagtccctgcaaatatgcctcgttttggttttagtcctt |
32418372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #238
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 122 - 155
Target Start/End: Complemental strand, 38456791 - 38456758
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatat |
155 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
38456791 |
taggctaaaatatgcttttggtccctgcaaatat |
38456758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #239
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 123 - 156
Target Start/End: Original strand, 39439923 - 39439956
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatg |
156 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
39439923 |
aggctaaaatatgattttggtccctgcaaatatg |
39439956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #240
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 196 - 232
Target Start/End: Original strand, 2811513 - 2811549
Alignment:
| Q |
196 |
tttttggtccctgcaaatatgcctcattttggttttg |
232 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
2811513 |
tttttgatccctgcaaatatacctcattttggttttg |
2811549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #241
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 120 - 176
Target Start/End: Complemental strand, 7578532 - 7578476
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||| ||||||||| |||||| | |||||||||||| ||| ||||||||||||||| |
|
|
| T |
7578532 |
tttaagctaaaatacggttttaattcctgcaaatatgactcattttggttttagtcc |
7578476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #242
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 124 - 156
Target Start/End: Original strand, 28398756 - 28398788
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatg |
156 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
28398756 |
ggctaaaatatggttttagtccctgcaaatatg |
28398788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #243
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 119 - 155
Target Start/End: Complemental strand, 28998057 - 28998021
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatat |
155 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
28998057 |
tttttggctaaaatatgtttttggtccctgcaaatat |
28998021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #244
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 143 - 179
Target Start/End: Complemental strand, 36044712 - 36044676
Alignment:
| Q |
143 |
tccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
36044712 |
tccctgcaaatatatctcgttttggttttggtccctg |
36044676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #245
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 123 - 155
Target Start/End: Original strand, 36588221 - 36588253
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatat |
155 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
36588221 |
aggctaaaatatgcttttggtccctgcaaatat |
36588253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 82; Significance: 8e-39; HSPs: 198)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 122 - 238
Target Start/End: Complemental strand, 10910966 - 10910850
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctca |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||| ||| |
|
|
| T |
10910966 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaataaatttgttgtttttggtccctgcaaatatgcatca |
10910867 |
T |
 |
| Q |
222 |
ttttggttttggtcctt |
238 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
10910866 |
ttttggttttggtcctt |
10910850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 119 - 236
Target Start/End: Original strand, 1007119 - 1007236
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
1007119 |
ttttaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgtaaattttttttgttgtttttggtccctgcaaatatgcc |
1007218 |
T |
 |
| Q |
219 |
tcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
1007219 |
tcattttggttttggtcc |
1007236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 120 - 236
Target Start/End: Complemental strand, 22543722 - 22543606
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcct |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| || |
|
|
| T |
22543722 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaatatgtct |
22543623 |
T |
 |
| Q |
220 |
cattttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
22543622 |
cattttggttttggtcc |
22543606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 123 - 236
Target Start/End: Original strand, 3968644 - 3968757
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| ||||| |
|
|
| T |
3968644 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaatatgtctcat |
3968743 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
3968744 |
tttggttttggtcc |
3968757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 126 - 235
Target Start/End: Original strand, 13617531 - 13617640
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcatttt |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
13617531 |
ctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctgtaaattttttttgttgtttttggtccctgcaaatatgcctcatttt |
13617630 |
T |
 |
| Q |
226 |
ggttttggtc |
235 |
Q |
| |
|
|||||||||| |
|
|
| T |
13617631 |
ggttttggtc |
13617640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 123 - 236
Target Start/End: Original strand, 21385250 - 21385363
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| ||||| |
|
|
| T |
21385250 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaaaatttttgttgtttttggtccctgcaaatatgtctcat |
21385349 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
21385350 |
tttggttttggtcc |
21385363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 124 - 236
Target Start/End: Original strand, 31198615 - 31198727
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcatt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
31198615 |
ggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctgcaaaattttgttgttgtttttggtccctgcaaatatgcctcatt |
31198714 |
T |
 |
| Q |
224 |
ttggttttggtcc |
236 |
Q |
| |
|
||||||||||||| |
|
|
| T |
31198715 |
ttggttttggtcc |
31198727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 118 - 236
Target Start/End: Complemental strand, 19129526 - 19129408
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgc |
217 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
19129526 |
attttaggctaaaatatgattttggtccctgcaaatatgtcacgttttggttttagtccctgtaattttatttttttgtttttggtccctgcaaatatgt |
19129427 |
T |
 |
| Q |
218 |
ctcattttggttttggtcc |
236 |
Q |
| |
|
||| ||||||||||||||| |
|
|
| T |
19129426 |
ctcgttttggttttggtcc |
19129408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 118 - 236
Target Start/End: Original strand, 24901233 - 24901350
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgc |
217 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| | ||| || ||||||||||||||||||||||||| |
|
|
| T |
24901233 |
atttttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt-cttgtaaaaaaaaattgttgtttttggtccctgcaaatatgc |
24901331 |
T |
 |
| Q |
218 |
ctcattttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
24901332 |
ctcattttggttttggtcc |
24901350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 123 - 236
Target Start/End: Complemental strand, 17765376 - 17765263
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
17765376 |
aggctaaaatatgattttggtccctgcaaatatgtctcgttttatttttagtccctgtaaatttttgttgttgtttttggtccctgcaaatatgcctcat |
17765277 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
17765276 |
tttggttttggtcc |
17765263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 120 - 236
Target Start/End: Complemental strand, 21994407 - 21994291
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcct |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||| || |
|
|
| T |
21994407 |
tttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaatatgtct |
21994308 |
T |
 |
| Q |
220 |
cattttggttttggtcc |
236 |
Q |
| |
|
| ||||||||||||||| |
|
|
| T |
21994307 |
ctttttggttttggtcc |
21994291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 123 - 236
Target Start/End: Original strand, 25136993 - 25137105
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
25136993 |
aggctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagtccctgt-aaaaaaaattgttgtttttggtccctgcaaatatgcctcat |
25137091 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
25137092 |
tttggttttggtcc |
25137105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 126 - 236
Target Start/End: Original strand, 19320769 - 19320879
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcatttt |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| ||||||| || ||||||||||||| ||||||||||||||||||| |
|
|
| T |
19320769 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttaatccctgtaagaattttttgttgtttttggtccttgcaaatatgcctcatttt |
19320868 |
T |
 |
| Q |
226 |
ggttttggtcc |
236 |
Q |
| |
|
||||||||||| |
|
|
| T |
19320869 |
ggttttggtcc |
19320879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 118 - 236
Target Start/End: Complemental strand, 25121502 - 25121385
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgc |
217 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
25121502 |
attttaggctaaaatatggttttggtgcctgcaaatatgtttcgttttggttttagtccctgtaattttttgtt-ttgtttttggtccctgcaaatatgt |
25121404 |
T |
 |
| Q |
218 |
ctcattttggttttggtcc |
236 |
Q |
| |
|
||||||||| ||||||||| |
|
|
| T |
25121403 |
ctcattttgattttggtcc |
25121385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 123 - 236
Target Start/End: Complemental strand, 6412580 - 6412467
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| || |||||||||||||||||||||||| ||||| |
|
|
| T |
6412580 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctcat |
6412481 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
6412480 |
tttggttttggtcc |
6412467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 123 - 235
Target Start/End: Complemental strand, 3276355 - 3276243
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| || | |||||||||| || |||||||||||||| |
|
|
| T |
3276355 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccttgtaaattttttttgtagtttttggtctctacaaatatgcctcat |
3276256 |
T |
 |
| Q |
223 |
tttggttttggtc |
235 |
Q |
| |
|
||||||||||||| |
|
|
| T |
3276255 |
tttggttttggtc |
3276243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 118 - 238
Target Start/End: Complemental strand, 6564949 - 6564831
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgc |
217 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||| || ||||||||||||| ||||||||||| |
|
|
| T |
6564949 |
attttaggctaaaat-tggttttggtccctgcaaatatgtctcgttttggttttagtctctgtaattttttgtt-ttgtttttggtccatgcaaatatgc |
6564852 |
T |
 |
| Q |
218 |
ctcattttggttttggtcctt |
238 |
Q |
| |
|
||| ||||||||||||||||| |
|
|
| T |
6564851 |
ctcgttttggttttggtcctt |
6564831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 123 - 236
Target Start/End: Complemental strand, 3414753 - 3414640
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| || |||||||||||||||||||||||| ||||| |
|
|
| T |
3414753 |
aggctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccctgcaaaaaaaaattgttgtttttggtccctgcaaatatgtctcat |
3414654 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|| |||||||||| |
|
|
| T |
3414653 |
ttgtgttttggtcc |
3414640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 122 - 236
Target Start/End: Complemental strand, 8170153 - 8170040
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctca |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| || ||||||||||||||| |||||||| |||| |
|
|
| T |
8170153 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcattgt-aaaaaaaattgttgtttttggtccctacaaatatgtctca |
8170055 |
T |
 |
| Q |
222 |
ttttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
8170054 |
ttttggttttggtcc |
8170040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 123 - 235
Target Start/End: Original strand, 19690392 - 19690505
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgttttt-ggtccctgcaaatatgcctca |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||| ||||| |||||||||| ||| |
|
|
| T |
19690392 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaattttttgttgttgtttttgggtccttgcaaatatgtctcg |
19690491 |
T |
 |
| Q |
222 |
ttttggttttggtc |
235 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
19690492 |
ttttggttttggtc |
19690505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 118 - 179
Target Start/End: Original strand, 6412212 - 6412273
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6412212 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
6412273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 123 - 236
Target Start/End: Original strand, 13268108 - 13268221
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| | || ||||||||||||||||||||||| ||| | |
|
|
| T |
13268108 |
aggctaaaatatggttttggtccctgcaaatatgcctcgtttaggttttagtccctataaaaataatttgatgtttttggtccctgcaaatatgtctcgt |
13268207 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
13268208 |
tttggttttggtcc |
13268221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 122 - 212
Target Start/End: Complemental strand, 3969011 - 3968921
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
3969011 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
3968921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 122 - 236
Target Start/End: Original strand, 15722608 - 15722722
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctca |
221 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||| || ||||||||||||| || ||||||||||| |
|
|
| T |
15722608 |
taggctaaaatatggttttggtctatgcaaatatgtctcgttttgattttagtccctgtaattttttgtttttgtttttggtccttgtaaatatgcctcg |
15722707 |
T |
 |
| Q |
222 |
ttttggttttggtcc |
236 |
Q |
| |
|
||||| ||||||||| |
|
|
| T |
15722708 |
ttttgattttggtcc |
15722722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 121 - 180
Target Start/End: Complemental strand, 18024378 - 18024319
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
18024378 |
ttaggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctgt |
18024319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 123 - 236
Target Start/End: Complemental strand, 19267913 - 19267802
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||| | ||||||||||||||||||| | |||||||||||||||||||||||| ||||| |
|
|
| T |
19267913 |
aggctaaaatatggttttggttcctgtaaatatgtcccattttggttttagtccctgtaattttttgt--ttgtttttggtccctgcaaatatgtctcat |
19267816 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
19267815 |
tttggttttggtcc |
19267802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 122 - 212
Target Start/End: Original strand, 21993785 - 21993875
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
21993785 |
taggctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
21993875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 121 - 180
Target Start/End: Complemental strand, 25431857 - 25431798
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25431857 |
ttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
25431798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 122 - 180
Target Start/End: Complemental strand, 1007511 - 1007453
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1007511 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
1007453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 122 - 180
Target Start/End: Original strand, 3414385 - 3414443
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3414385 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
3414443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 118 - 180
Target Start/End: Complemental strand, 12176649 - 12176587
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12176649 |
attttaggttaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
12176587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 122 - 180
Target Start/End: Complemental strand, 25137359 - 25137301
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25137359 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
25137301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 12757609 - 12757666
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
12757609 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcactgt |
12757666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 124 - 236
Target Start/End: Original strand, 14655903 - 14656015
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcatt |
223 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| | |||||||||||||||||||||| || |||||||||||| ||||||||||| || || |
|
|
| T |
14655903 |
ggctaaaacatggttttggtccctgcaaatatatttcgttttggttttagtccctgtaaaataaaattgttgtttttggtctttgcaaatatgcatcgtt |
14656002 |
T |
 |
| Q |
224 |
ttggttttggtcc |
236 |
Q |
| |
|
||||||||||||| |
|
|
| T |
14656003 |
ttggttttggtcc |
14656015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 14656261 - 14656204
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
14656261 |
aggctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctgt |
14656204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 122 - 179
Target Start/End: Original strand, 22543352 - 22543409
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
22543352 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
22543409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 30928680 - 30928737
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30928680 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
30928737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 118 - 174
Target Start/End: Complemental strand, 19321137 - 19321081
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
19321137 |
attttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
19321081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 123 - 174
Target Start/End: Original strand, 17765008 - 17765059
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17765008 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
17765059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 125 - 180
Target Start/End: Original strand, 23770162 - 23770217
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23770162 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
23770217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 127 - 236
Target Start/End: Original strand, 20467354 - 20467463
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattttg |
226 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||||||||||||||||| || ||||||||| |||| | ||||||| ||||||||| |
|
|
| T |
20467354 |
taaaatatagttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttgatcccggtaaatatgtctcattttg |
20467453 |
T |
 |
| Q |
227 |
gttttggtcc |
236 |
Q |
| |
|
|||||||||| |
|
|
| T |
20467454 |
gttttggtcc |
20467463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 122 - 180
Target Start/End: Original strand, 21147402 - 21147460
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
21147402 |
taggctaaaatatggttttggtccctgcaaatatgcatcgttttggttttagtccctgt |
21147460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 119 - 180
Target Start/End: Original strand, 317807 - 317868
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
317807 |
ttttaggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagcccctgt |
317868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 121 - 178
Target Start/End: Complemental strand, 1214999 - 1214942
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
1214999 |
ttaggctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagtccct |
1214942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 118 - 179
Target Start/End: Complemental strand, 1890458 - 1890397
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
1890458 |
attttaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
1890397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 122 - 179
Target Start/End: Complemental strand, 7156162 - 7156105
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7156162 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
7156105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 127 - 236
Target Start/End: Original strand, 12298825 - 12298930
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattttg |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||| | || || |||||||||| |||||||||| ||| ||||| |
|
|
| T |
12298825 |
taaaatatggttttggtccctgcaaatatgtctcgttttcgttttagtcccttt----aattttttttttttttggtccatgcaaatatgtctcgttttg |
12298920 |
T |
 |
| Q |
227 |
gttttggtcc |
236 |
Q |
| |
|
|||||||||| |
|
|
| T |
12298921 |
gttttggtcc |
12298930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 12299141 - 12299084
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
12299141 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctgt |
12299084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 122 - 179
Target Start/End: Complemental strand, 20467720 - 20467663
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
20467720 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctg |
20467663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 23502541 - 23502484
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
23502541 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttactccctgt |
23502484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 122 - 179
Target Start/End: Complemental strand, 24692981 - 24692924
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
24692981 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtccctg |
24692924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 124 - 180
Target Start/End: Original strand, 10910629 - 10910685
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
10910629 |
ggctaaaatatggttttggtctctacaaatatgtctcgttttggttttagtccctgt |
10910685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 15076205 - 15076149
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
15076205 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
15076149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 124 - 180
Target Start/End: Complemental strand, 15962389 - 15962333
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15962389 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
15962333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 21385585 - 21385529
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
21385585 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
21385529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 24274132 - 24274076
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
24274132 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
24274076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 33801744 - 33801688
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33801744 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
33801688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 124 - 180
Target Start/End: Original strand, 34582529 - 34582585
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34582529 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
34582585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 120 - 179
Target Start/End: Original strand, 15962023 - 15962082
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
15962023 |
tttaggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
15962082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 121 - 180
Target Start/End: Complemental strand, 34582895 - 34582836
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34582895 |
ttaggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccctgt |
34582836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 122 - 180
Target Start/End: Complemental strand, 318099 - 318041
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
318099 |
taggctaaaatatggttttaatccctgcaaatatgtttcgttttggttttagtccctgt |
318041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 116 - 178
Target Start/End: Original strand, 2615864 - 2615926
Alignment:
| Q |
116 |
tgattttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2615864 |
tgattctaggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccct |
2615926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 123 - 177
Target Start/End: Original strand, 11448536 - 11448590
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
177 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
11448536 |
aggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtccc |
11448590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 122 - 236
Target Start/End: Complemental strand, 11926035 - 11925922
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctca |
221 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||||||| ||||||||||||||| | ||| || ||||||||||||||| |||||||| ||| |
|
|
| T |
11926035 |
taggctaaaatatggttttggtctctgaaaatatgtcgcgttttggttttagttcttgt-aaaaaaaattgttgtttttggtcccttcaaatatgtctcg |
11925937 |
T |
 |
| Q |
222 |
ttttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
11925936 |
ttttggttttggtcc |
11925922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 121 - 179
Target Start/End: Original strand, 14655376 - 14655434
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
14655376 |
ttaggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
14655434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 125 - 179
Target Start/End: Original strand, 31166871 - 31166925
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
31166871 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
31166925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 119 - 176
Target Start/End: Original strand, 494400 - 494457
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
494400 |
tttttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
494457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 236
Target Start/End: Original strand, 1214695 - 1214806
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| | ||||||||||||||||| | || |||||||||||||||||||||||| || | |
|
|
| T |
1214695 |
aggctaaaatattgttttggtccctgcaaatatgtcgcattttggttttagtccctat--atatttttttttgtttttggtccctgcaaatatgtcttgt |
1214792 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
||||||||| |||| |
|
|
| T |
1214793 |
tttggttttagtcc |
1214806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 122 - 178
Target Start/End: Original strand, 6564579 - 6564636
Alignment:
| Q |
122 |
taggctaaaatatggtttt-ggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6564579 |
taggctaaattatggtttttggtccctgcaaatatgtctcgttttggttttagtccct |
6564636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 122 - 179
Target Start/End: Original strand, 8680773 - 8680830
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8680773 |
taggctaaaatatgtttttagtccctgcaaatatgcctcgttttggttttagtccctg |
8680830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 176
Target Start/End: Complemental strand, 9896638 - 9896585
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
9896638 |
aggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtcc |
9896585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 127 - 180
Target Start/End: Original strand, 10091039 - 10091092
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
10091039 |
taaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgt |
10091092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 122 - 179
Target Start/End: Complemental strand, 12419940 - 12419883
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
12419940 |
taggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
12419883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 119 - 180
Target Start/End: Complemental strand, 12612364 - 12612303
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
12612364 |
ttttaggctaaaatatggtgttagtccctgcaaatatgcctcgttttagttttagtccctgt |
12612303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 122 - 179
Target Start/End: Original strand, 19129334 - 19129391
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
19129334 |
taggctacaatatggctttggtccctgcaaatatgcctcgttttggttttagtccctg |
19129391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 21995063 - 21995120
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
21995063 |
aggctaaaatatggttttagtccctgcatatatgcctcgttttggttttagtccctgt |
21995120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 26375692 - 26375749
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
26375692 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttaatccctgt |
26375749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 127 - 180
Target Start/End: Complemental strand, 26376042 - 26375989
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26376042 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
26375989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 124 - 235
Target Start/End: Complemental strand, 31186591 - 31186479
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgttt-ttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
||||||||||||||||| || |||||||||||| |||||||| |||||||||||||| || |||||| ||||||| ||||||||||| |||| |
|
|
| T |
31186591 |
ggctaaaatatggtttttgtgcctgcaaatatgcctcgtttttgttttagtccctgtaaaaaaaaattgttgtttattggtccatgcaaatatgcttcat |
31186492 |
T |
 |
| Q |
223 |
tttggttttggtc |
235 |
Q |
| |
|
||| ||||||||| |
|
|
| T |
31186491 |
tttagttttggtc |
31186479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 122 - 179
Target Start/End: Original strand, 32885671 - 32885728
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32885671 |
taggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
32885728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 123 - 179
Target Start/End: Original strand, 7155796 - 7155852
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7155796 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
7155852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 8681117 - 8681061
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
8681117 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
8681061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 120 - 180
Target Start/End: Original strand, 14428646 - 14428706
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||| |||||||||||||||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
14428646 |
tttaagctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgt |
14428706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 124 - 180
Target Start/End: Original strand, 19267565 - 19267621
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
19267565 |
ggctaaaatatggttttggtccctgtaaatatgcttcgttttggttttagtccctgt |
19267621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 124 - 180
Target Start/End: Complemental strand, 19296407 - 19296351
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
19296407 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctgt |
19296351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 22822652 - 22822596
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
22822652 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
22822596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 123 - 171
Target Start/End: Original strand, 23502236 - 23502284
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttt |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
23502236 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
23502284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 124 - 180
Target Start/End: Complemental strand, 30929044 - 30928988
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30929044 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt |
30928988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 119 - 179
Target Start/End: Complemental strand, 31167205 - 31167145
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
31167205 |
tttttggctaaaatatggttttagtccctgcaaatatggctcgttttgattttagtccctg |
31167145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 125 - 172
Target Start/End: Complemental strand, 494751 - 494704
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
172 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
494751 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
494704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 128 - 179
Target Start/End: Original strand, 543365 - 543416
Alignment:
| Q |
128 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
543365 |
aaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
543416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 127 - 178
Target Start/End: Complemental strand, 3356495 - 3356444
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3356495 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
3356444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #93
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 125 - 180
Target Start/End: Original strand, 23628799 - 23628854
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||||||||||||||||| |||| |
|
|
| T |
23628799 |
gctaaaatatggttttggtccctgcaaatatatttcgttttggttttagtcactgt |
23628854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #94
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 127 - 235
Target Start/End: Complemental strand, 27765173 - 27765063
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgtt----ttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| ||||||||||||| ||| || |||||||||||||||||||||||| ||| | |
|
|
| T |
27765173 |
taaaatatggttttggtccctgcaaatatatctcgttcgttttggttttagtccttgtaattttt--ttgttgtttttggtccctgcaaatatgtctcgt |
27765076 |
T |
 |
| Q |
223 |
tttggttttggtc |
235 |
Q |
| |
|
||||||||||||| |
|
|
| T |
27765075 |
tttggttttggtc |
27765063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #95
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 125 - 180
Target Start/End: Complemental strand, 30479421 - 30479366
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||| | |||||||||| ||||||||||||||||||||||| |
|
|
| T |
30479421 |
gctaaaatatggttttggttcatgcaaatatgcctcgttttggttttagtccctgt |
30479366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #96
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 125 - 180
Target Start/End: Complemental strand, 31276339 - 31276284
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
31276339 |
gctaaaataaagttttggtccctgcaaatatgtctcgttttgattttagtccctgt |
31276284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #97
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 122 - 180
Target Start/End: Complemental strand, 7324194 - 7324136
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7324194 |
taggttaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgt |
7324136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #98
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 122 - 176
Target Start/End: Original strand, 12419706 - 12419760
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
12419706 |
taggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtcc |
12419760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #99
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 120 - 180
Target Start/End: Complemental strand, 13617817 - 13617760
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
13617817 |
tttaggctaaaat---gttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
13617760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #100
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 124 - 236
Target Start/End: Original strand, 15442937 - 15443047
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcatt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| ||||||| ||| | || ||||||||||||||||||| ||| | |||| |
|
|
| T |
15442937 |
ggctaaaatatggttttggtccctgcaaatatacctcgttttgattttagtgcctctaaattatttttgttgtttttggtccctgcaa--atgtcacatt |
15443034 |
T |
 |
| Q |
224 |
ttggttttggtcc |
236 |
Q |
| |
|
||||||||||||| |
|
|
| T |
15443035 |
ttggttttggtcc |
15443047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #101
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 123 - 177
Target Start/End: Complemental strand, 22792900 - 22792846
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
177 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
22792900 |
aggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagtccc |
22792846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #102
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 124 - 178
Target Start/End: Original strand, 30239293 - 30239347
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
|||||||||||| |||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
30239293 |
ggctaaaatatgattttagttcctgcaaatatgtctcgttttggttttagtccct |
30239347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #103
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 2373178 - 2373235
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| || ||||||||| |||||||||| |
|
|
| T |
2373178 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttatagtccctgt |
2373235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #104
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 123 - 176
Target Start/End: Original strand, 3356141 - 3356194
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
3356141 |
aggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtcc |
3356194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #105
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 126 - 179
Target Start/End: Complemental strand, 5286949 - 5286896
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
5286949 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
5286896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #106
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 6468309 - 6468366
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
6468309 |
aggctaaaatatggttttagtccctgcaaatatgctttgttttggttttagtccctgt |
6468366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #107
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 11449170 - 11449113
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| |||||||||||| |||||||||| |
|
|
| T |
11449170 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttgtagtccctgt |
11449113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #108
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 13150751 - 13150694
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13150751 |
aggctaaaatatggtattaacccctgcaaatatgtctcgttttggttttagtccctgt |
13150694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #109
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 127 - 180
Target Start/End: Original strand, 18024014 - 18024067
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
18024014 |
taaaatatggttttggtctttgcaaatatgcctcgttttggttttagtccctgt |
18024067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #110
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 123 - 176
Target Start/End: Complemental strand, 31398542 - 31398489
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
31398542 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtcc |
31398489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #111
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 33131851 - 33131794
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
33131851 |
aggctaaaatatggttttagtctttgcaaatatgcctcgttttggttttagtccctgt |
33131794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #112
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 127 - 180
Target Start/End: Complemental strand, 34990312 - 34990259
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34990312 |
taaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgt |
34990259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #113
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 126 - 174
Target Start/End: Complemental strand, 6591440 - 6591392
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
174 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
6591440 |
ctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagt |
6591392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #114
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 124 - 180
Target Start/End: Original strand, 11925739 - 11925795
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
11925739 |
ggctaatatatgattttggtccctgcaaatatgtctcgttttgattttagtctctgt |
11925795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #115
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 124 - 236
Target Start/End: Complemental strand, 12757936 - 12757825
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcatt |
223 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||| || ||||||||||| ||| ||| || ||||||||||||| ||||||||||| || || |
|
|
| T |
12757936 |
ggctaaaacatgattttggtccctgcaaatatgtatccttttggttttaatccttgt-aaaaaaaattgttgtttttggtccttgcaaatatgcatcgtt |
12757838 |
T |
 |
| Q |
224 |
ttggttttggtcc |
236 |
Q |
| |
|
||||||||||||| |
|
|
| T |
12757837 |
ttggttttggtcc |
12757825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #116
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 124 - 176
Target Start/End: Original strand, 17771911 - 17771963
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
17771911 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtcc |
17771963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #117
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 128 - 176
Target Start/End: Complemental strand, 19690755 - 19690708
Alignment:
| Q |
128 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
19690755 |
aaaatatggttttggtccctgcaaatatgtctcgtttt-gttttagtcc |
19690708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #118
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 124 - 180
Target Start/End: Complemental strand, 21995425 - 21995369
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| |||||||||| |||||||||||| |
|
|
| T |
21995425 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggctttagtccctgt |
21995369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #119
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 123 - 179
Target Start/End: Original strand, 24273827 - 24273883
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
24273827 |
aggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagttcctg |
24273883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #120
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 123 - 179
Target Start/End: Original strand, 33808619 - 33808675
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| ||||||||| |||||||||||| |
|
|
| T |
33808619 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttgattttagtccctg |
33808675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #121
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 122 - 169
Target Start/End: Original strand, 30479061 - 30479108
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggtt |
169 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
30479061 |
taggctaaaatatggttttggtccctgtaaatatgtcccgttttggtt |
30479108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #122
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 1214767 - 1214809
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
1214767 |
ttttggtccctgcaaatatgtcttgttttggttttagtccctg |
1214809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #123
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 126 - 180
Target Start/End: Original strand, 9896280 - 9896334
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
9896280 |
ctaaaatatggttttaatccctgcaaatatgtctcattttagttttagtccctgt |
9896334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #124
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 13268182 - 13268224
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
13268182 |
ttttggtccctgcaaatatgtctcgttttggttttggtccctg |
13268224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #125
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 19129447 - 19129405
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
19129447 |
ttttggtccctgcaaatatgtctcgttttggttttggtccctg |
19129405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #126
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 137 - 175
Target Start/End: Complemental strand, 19275223 - 19275185
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtc |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19275223 |
ttttggtccctgcaaatatgtctcgttttggttttagtc |
19275185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #127
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 122 - 180
Target Start/End: Complemental strand, 24901556 - 24901498
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||| || ||||||||||||||||||| |
|
|
| T |
24901556 |
taggctaaaatatgattttggtccctacaaatatgacttattttggttttagtccctgt |
24901498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #128
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 19296107 - 19296164
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
19296107 |
aggctaaaacatggttttagtccctgcaaatatgcgtcgttttgattttagtccctgt |
19296164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #129
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 122 - 175
Target Start/End: Original strand, 25121182 - 25121234
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
175 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
25121182 |
taggctaaaatatggttttcatcc-tgcaaatatgtctcgttttggttttagtc |
25121234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #130
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 123 - 179
Target Start/End: Original strand, 777676 - 777732
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||| |||| || ||||||||||| |||||||||||||||||||||| |
|
|
| T |
777676 |
aggctaaaatatgattttagttcctgcaaatatacctcgttttggttttagtccctg |
777732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #131
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 122 - 174
Target Start/End: Complemental strand, 778044 - 777992
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
174 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||| |||||||| |
|
|
| T |
778044 |
taggctaaaatatggttttaatccctgcaaatatgcctcgttttagttttagt |
777992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #132
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 127 - 179
Target Start/End: Original strand, 1890062 - 1890114
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||| ||||||| ||||||| ||||||||| |||||||||||| |
|
|
| T |
1890062 |
taaaatatggttttagtccctgtaaatatgcctcgttttgattttagtccctg |
1890114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #133
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 123 - 171
Target Start/End: Complemental strand, 2616241 - 2616193
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttt |
171 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| || ||||||||||| |
|
|
| T |
2616241 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggtttt |
2616193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #134
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 123 - 171
Target Start/End: Original strand, 6591114 - 6591162
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttt |
171 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||| |||||||||||||| |
|
|
| T |
6591114 |
aggctaaaatatggttttagtccccgcaaatatgcctcgttttggtttt |
6591162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #135
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 119 - 174
Target Start/End: Original strand, 15116668 - 15116721
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
174 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||| |||||||||||||||||| |
|
|
| T |
15116668 |
ttttaggctaaaatatggttttagtcgctgcaaata--tctcgttttggttttagt |
15116721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #136
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 121 - 165
Target Start/End: Complemental strand, 23770442 - 23770398
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgtttt |
165 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
23770442 |
ttaggctaaaatatggttttagtccctgcaaatatgcctcgtttt |
23770398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #137
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 21385571 - 21385532
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
21385571 |
ttttggtccctgcaaatatgcctcattttggttttagtcc |
21385532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #138
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 123 - 174
Target Start/End: Original strand, 22822306 - 22822357
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
174 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||| ||||||||||||||||| |
|
|
| T |
22822306 |
aggctaaaatatggttttagtctctgcaaatatacctcgttttggttttagt |
22822357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #139
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 197 - 236
Target Start/End: Original strand, 31276115 - 31276154
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
31276115 |
ttttggtccctacaaatatgcctcattttggttttggtcc |
31276154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #140
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 125 - 176
Target Start/End: Original strand, 34989962 - 34990013
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
34989962 |
gctaaaatatgcttttagtccctgcaaatatgcctcgttttgattttagtcc |
34990013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #141
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 118 - 180
Target Start/End: Original strand, 1875496 - 1875558
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| | ||| |||||||||||||| |||||||||| ||| |||||||| |
|
|
| T |
1875496 |
attttaggctaaaatatagctttaatccctgcaaatatgcctcgttttgggtttggtccctgt |
1875558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #142
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 3968718 - 3968760
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
3968718 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
3968760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #143
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 6412506 - 6412464
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
6412506 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
6412464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #144
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 122 - 180
Target Start/End: Original strand, 8169785 - 8169843
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||| | |||||| ||||| ||||||| |
|
|
| T |
8169785 |
taggctaaaatatgattttggtccatgcaaatatgttttgttttgattttactccctgt |
8169843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #145
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 12298891 - 12298933
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
12298891 |
ttttggtccatgcaaatatgtctcgttttggttttggtccctg |
12298933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #146
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 126 - 176
Target Start/End: Complemental strand, 14428948 - 14428898
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||||||| |||| |||||||||| |||||||||||||||||| |
|
|
| T |
14428948 |
ctaaaatatggttttagtccttgcaaatatgcttcgttttggttttagtcc |
14428898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #147
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 19267841 - 19267799
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
19267841 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
19267799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #148
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 21385324 - 21385366
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
21385324 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
21385366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #149
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 21994330 - 21994288
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
21994330 |
ttttggtccctgcaaatatgtctctttttggttttggtccctg |
21994288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #150
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 22543645 - 22543603
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
22543645 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
22543603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #151
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 197 - 235
Target Start/End: Original strand, 23502250 - 23502288
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtc |
235 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
23502250 |
ttttggtccctgcaaatatgcctcgttttggttttggtc |
23502288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #152
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 122 - 179
Target Start/End: Complemental strand, 543726 - 543669
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| | |||||||||||| |||||| |
|
|
| T |
543726 |
taggctaaaatatgattttagtccctgcaaatatgctttgttttggttttaatccctg |
543669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #153
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 147 - 180
Target Start/End: Original strand, 7323891 - 7323924
Alignment:
| Q |
147 |
tgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
7323891 |
tgcaaatatgtctcgttttggttttagtccctgt |
7323924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #154
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 124 - 165
Target Start/End: Complemental strand, 13268460 - 13268419
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgtttt |
165 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
13268460 |
ggctaaaataaggttttggtccctgcaaatatgtctggtttt |
13268419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #155
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 119 - 156
Target Start/End: Complemental strand, 17517373 - 17517336
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatg |
156 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
17517373 |
ttttaggctaaaatatgtttttggtccctgcaaatatg |
17517336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #156
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 119 - 171
Target Start/End: Complemental strand, 11129548 - 11129496
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttt |
171 |
Q |
| |
|
|||| |||||||||||| |||| |||||||||||||| |||||||||||||| |
|
|
| T |
11129548 |
tttttggctaaaatatgattttactccctgcaaatatgcctcgttttggtttt |
11129496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #157
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 124 - 176
Target Start/End: Original strand, 12176385 - 12176437
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||||||||| | || || |||||||||||||||| |||||||||| |
|
|
| T |
12176385 |
ggctaaaatatggttttagcccatgtaaatatgtctcgttttagttttagtcc |
12176437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #158
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 119 - 171
Target Start/End: Complemental strand, 23629107 - 23629055
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttt |
171 |
Q |
| |
|
||||| ||||||||||||||||||| ||| |||||||||||| |||| ||||| |
|
|
| T |
23629107 |
ttttaagctaaaatatggttttggttcctacaaatatgtctcattttagtttt |
23629055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #159
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 125 - 169
Target Start/End: Original strand, 27764914 - 27764958
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtt |
169 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||| |||||||| |
|
|
| T |
27764914 |
gctaaaatatggttttagtccctacaaatatgtctcattttggtt |
27764958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #160
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 127 - 179
Target Start/End: Original strand, 31276105 - 31276157
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||| |||||||||||||||| |||||||| ||| |||||||||| ||||||| |
|
|
| T |
31276105 |
taaactatggttttggtccctacaaatatgcctcattttggttttggtccctg |
31276157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #161
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 1007496 - 1007457
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
1007496 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
1007457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #162
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 120 - 155
Target Start/End: Original strand, 3276363 - 3276398
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatat |
155 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3276363 |
tttaggctaaaatatgtttttggtccctgcaaatat |
3276398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #163
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 119 - 178
Target Start/End: Complemental strand, 3345409 - 3345350
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
3345409 |
ttttaggcttaaatatggaaatggtccctgcaaatatctggcgttttggttttagtccct |
3345350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #164
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Original strand, 3414400 - 3414439
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
3414400 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
3414439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #165
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 3968996 - 3968957
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
3968996 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
3968957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #166
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 5286938 - 5286899
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
5286938 |
ttttagtccctgcaaatatgcctcattttggttttagtcc |
5286899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #167
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 13617803 - 13617764
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
13617803 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
13617764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #168
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 124 - 155
Target Start/End: Complemental strand, 20897556 - 20897525
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatat |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
20897556 |
ggctaaaatatggttttggtccctgcaaatat |
20897525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #169
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Original strand, 22543367 - 22543406
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
22543367 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
22543406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #170
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 25137344 - 25137305
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
25137344 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
25137305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #171
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 130 - 169
Target Start/End: Complemental strand, 32885960 - 32885921
Alignment:
| Q |
130 |
aatatggttttggtccctgcaaatatgtctcgttttggtt |
169 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
32885960 |
aatatggttttagtccctgcaaatatgtctcattttggtt |
32885921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #172
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 1007197 - 1007239
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||||| |
|
|
| T |
1007197 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
1007239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #173
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 190 - 236
Target Start/End: Original strand, 6564588 - 6564634
Alignment:
| Q |
190 |
ttattgtttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||| |||||||||||||||||||||| ||| |||||||||| |||| |
|
|
| T |
6564588 |
ttatggtttttggtccctgcaaatatgtctcgttttggttttagtcc |
6564634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #174
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 8170079 - 8170037
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||| ||||||| |
|
|
| T |
8170079 |
ttttggtccctacaaatatgtctcattttggttttggtccctg |
8170037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #175
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 194 - 236
Target Start/End: Original strand, 8680785 - 8680827
Alignment:
| Q |
194 |
tgtttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||| |||| |
|
|
| T |
8680785 |
tgtttttagtccctgcaaatatgcctcgttttggttttagtcc |
8680827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #176
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 197 - 231
Target Start/End: Complemental strand, 12299127 - 12299093
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggtttt |
231 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
12299127 |
ttttggtccctgcaaatatgcctcgttttggtttt |
12299093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #177
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 122 - 180
Target Start/End: Complemental strand, 15722902 - 15722844
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||| |||||| | |||||||||||| || || |||||||||||| |||| |
|
|
| T |
15722902 |
taggctaaaatatagttttgattcctgcaaatatgccttgtgttggttttagtctctgt |
15722844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #178
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 198 - 236
Target Start/End: Original strand, 19129350 - 19129388
Alignment:
| Q |
198 |
tttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
19129350 |
tttggtccctgcaaatatgcctcgttttggttttagtcc |
19129388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #179
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 126 - 231
Target Start/End: Complemental strand, 19275289 - 19275189
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcatttt |
225 |
Q |
| |
|
||||||||||||||| |||| ||||||| ||||||||||||||||| |||| || | |||||||||||||||||||||| ||| |||| |
|
|
| T |
19275289 |
ctaaaatatggttttagtccatgcaaat-----tcgttttggttttagtctctgtaatttttttttttagtttttggtccctgcaaatatgtctcgtttt |
19275195 |
T |
 |
| Q |
226 |
ggtttt |
231 |
Q |
| |
|
|||||| |
|
|
| T |
19275194 |
ggtttt |
19275189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #180
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 122 - 180
Target Start/End: Complemental strand, 19276041 - 19275983
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||| |||||||| ||||| |||||| ||||||| ||| ||||||||||||||||||| |
|
|
| T |
19276041 |
taggttaaaatatagttttagtccctacaaatatacctcattttggttttagtccctgt |
19275983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #181
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 197 - 231
Target Start/End: Complemental strand, 19321118 - 19321084
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggtttt |
231 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
19321118 |
ttttggtccctgcaaatatgcctcgttttggtttt |
19321084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #182
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 197 - 231
Target Start/End: Complemental strand, 20467705 - 20467671
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggtttt |
231 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
20467705 |
ttttggtccctgcaaatatgcctcgttttggtttt |
20467671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #183
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 121 - 155
Target Start/End: Original strand, 21953203 - 21953237
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatat |
155 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
21953203 |
ttaggctaaaatatgcttttggtccctgcaaatat |
21953237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #184
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 24901311 - 24901353
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||||| |
|
|
| T |
24901311 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
24901353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #185
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 25121424 - 25121382
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||| ||||||| |
|
|
| T |
25121424 |
ttttggtccctgcaaatatgtctcattttgattttggtccctg |
25121382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #186
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 25137066 - 25137108
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||||| |
|
|
| T |
25137066 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
25137108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #187
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 30479132 - 30479174
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||| ||||||| |
|
|
| T |
30479132 |
ttttggtccctgcaaatatatctcgttttagttttggtccctg |
30479174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #188
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 31198688 - 31198730
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||||| |
|
|
| T |
31198688 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
31198730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #189
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 197 - 238
Target Start/End: Original strand, 494418 - 494459
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcctt |
238 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
494418 |
ttttagtccctgcaaatatgcctcgttttggttttagtcctt |
494459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #190
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 197 - 238
Target Start/End: Complemental strand, 3276341 - 3276300
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcctt |
238 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| |||||| |
|
|
| T |
3276341 |
ttttggtccctgcaaatatgtctcgttttggttttagtcctt |
3276300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #191
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 123 - 156
Target Start/End: Complemental strand, 15117041 - 15117008
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatg |
156 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |
|
|
| T |
15117041 |
aggctaaaatatggttttagtccctgcaaatatg |
15117008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #192
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 137 - 178
Target Start/End: Complemental strand, 17765302 - 17765261
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| |||||| |
|
|
| T |
17765302 |
ttttggtccctgcaaatatgcctcattttggttttggtccct |
17765261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #193
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 25431575 - 25431632
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||| |||| |||||| |||||||| |||||||| ||||||| ||||| |
|
|
| T |
25431575 |
aggctaaaatatgattttaatccctgtaaatatgtttcgttttgattttagttcctgt |
25431632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #194
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 29291358 - 29291415
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||| | |||| |||||| |||||||| |
|
|
| T |
29291358 |
aggctaaaatatgcttttggtccttgcaaatatggcgagtttgggttttggtccctgt |
29291415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #195
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 122 - 179
Target Start/End: Original strand, 29819411 - 29819468
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||| |||||||| |||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
29819411 |
taggcttaaatatggaaatggtccctgcaaatatctggcgttttggttttagtccctg |
29819468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #196
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 197 - 238
Target Start/End: Complemental strand, 31398528 - 31398487
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcctt |
238 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
31398528 |
ttttagtccctgcaaatatgtctcattttggttttagtcctt |
31398487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #197
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 118 - 178
Target Start/End: Complemental strand, 16465238 - 16465178
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
|||||||| | ||||||| ||||||||||| |||||||||| |||| |||||||||||| |
|
|
| T |
16465238 |
attttagggttaaatatgtttttggtccctataaatatgtctacttttcgttttagtccct |
16465178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #198
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 123 - 155
Target Start/End: Original strand, 16995450 - 16995482
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatat |
155 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
16995450 |
aggctaaaatatgtttttggtccctgcaaatat |
16995482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 82; Significance: 8e-39; HSPs: 302)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 124 - 236
Target Start/End: Original strand, 4034717 - 4034829
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcatt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
4034717 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaatatgcctcatt |
4034816 |
T |
 |
| Q |
224 |
ttggttttggtcc |
236 |
Q |
| |
|
||||||||||||| |
|
|
| T |
4034817 |
ttggttttggtcc |
4034829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 119 - 236
Target Start/End: Original strand, 12740902 - 12741019
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| | |
|
|
| T |
12740902 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaatatgtc |
12741001 |
T |
 |
| Q |
219 |
tcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
12741002 |
tcattttggttttggtcc |
12741019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 121 - 236
Target Start/End: Complemental strand, 28552386 - 28552271
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctc |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||| ||| |
|
|
| T |
28552386 |
ttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaattttttgttgtttttggtccctgcaaatatgtctc |
28552287 |
T |
 |
| Q |
221 |
attttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
28552286 |
attttggttttggtcc |
28552271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 122 - 236
Target Start/End: Complemental strand, 474410 - 474296
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctca |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| || |||||||||||||||||||||||| |||| |
|
|
| T |
474410 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctca |
474311 |
T |
 |
| Q |
222 |
ttttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
474310 |
ttttggttttggtcc |
474296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 127 - 236
Target Start/End: Original strand, 3387268 - 3387377
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattttg |
226 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
3387268 |
taaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctgaaaaaaaaatttgttgtttttggtccctgcaaatatgcctcattttg |
3387367 |
T |
 |
| Q |
227 |
gttttggtcc |
236 |
Q |
| |
|
|||||||||| |
|
|
| T |
3387368 |
gttttggtcc |
3387377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 123 - 236
Target Start/End: Original strand, 54608517 - 54608630
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||| ||||| |
|
|
| T |
54608517 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaattttttgttgtttttggtccctgcaaatatgtctcat |
54608616 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
54608617 |
tttggttttggtcc |
54608630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 124 - 236
Target Start/End: Complemental strand, 22008890 - 22008778
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcatt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||| |||||| |
|
|
| T |
22008890 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaatatgtctcatt |
22008791 |
T |
 |
| Q |
224 |
ttggttttggtcc |
236 |
Q |
| |
|
||||||||||||| |
|
|
| T |
22008790 |
ttggttttggtcc |
22008778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 122 - 238
Target Start/End: Complemental strand, 30034474 - 30034358
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctca |
221 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||| || |||||||||||||||| |||||||||||| |
|
|
| T |
30034474 |
taggctaaaatatggttttgctccttgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgtaaatatgcctca |
30034375 |
T |
 |
| Q |
222 |
ttttggttttggtcctt |
238 |
Q |
| |
|
||||| ||||||||||| |
|
|
| T |
30034374 |
ttttgattttggtcctt |
30034358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 123 - 231
Target Start/End: Original strand, 35565507 - 35565615
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
35565507 |
aggctaaaatatggttttgttccctgcaaatatacctcgttttggttttagtccctgtaattttttgttattgtttttggtccctgcaaatatgcctcat |
35565606 |
T |
 |
| Q |
223 |
tttggtttt |
231 |
Q |
| |
|
||||||||| |
|
|
| T |
35565607 |
tttggtttt |
35565615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 118 - 242
Target Start/End: Original strand, 47336222 - 47336346
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgc |
217 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
47336222 |
atttaaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaatatgt |
47336321 |
T |
 |
| Q |
218 |
ctcattttggttttggtcctttgct |
242 |
Q |
| |
|
||||||||||||||||||| ||||| |
|
|
| T |
47336322 |
ctcattttggttttggtcccttgct |
47336346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 122 - 236
Target Start/End: Complemental strand, 49324148 - 49324034
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctca |
221 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||||||||||||||||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
49324148 |
taggataaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaatatgtctca |
49324049 |
T |
 |
| Q |
222 |
ttttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
49324048 |
ttttggttttggtcc |
49324034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 122 - 232
Target Start/End: Original strand, 51550080 - 51550190
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctca |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
51550080 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctca |
51550179 |
T |
 |
| Q |
222 |
ttttggttttg |
232 |
Q |
| |
|
||||||||||| |
|
|
| T |
51550180 |
ttttggttttg |
51550190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 127 - 236
Target Start/End: Complemental strand, 863649 - 863540
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattttg |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| ||||||||||||| || |||||||||||||||||||||||| ||||||||| |
|
|
| T |
863649 |
taaaatatggttttggtccctgcaaatatgtttcgttttgattttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaatatgtctcattttg |
863550 |
T |
 |
| Q |
227 |
gttttggtcc |
236 |
Q |
| |
|
|||||||||| |
|
|
| T |
863549 |
gttttggtcc |
863540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 123 - 236
Target Start/End: Complemental strand, 9597096 - 9596983
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||| ||||||| |
|
|
| T |
9597096 |
aggctaaaatatggttttgttccctgcaaatatgcttcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaatacgcctcat |
9596997 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
9596996 |
tttggttttggtcc |
9596983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 119 - 236
Target Start/End: Complemental strand, 31480505 - 31480388
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcc |
218 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||| | |
|
|
| T |
31480505 |
tttttggctaaaatatggatttggtccctgcaaatatgcctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaatatgtc |
31480406 |
T |
 |
| Q |
219 |
tcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
31480405 |
tcattttggttttggtcc |
31480388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 123 - 236
Target Start/End: Complemental strand, 32119585 - 32119472
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||| ||||| |
|
|
| T |
32119585 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctcat |
32119486 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
32119485 |
tttggttttggtcc |
32119472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 127 - 236
Target Start/End: Original strand, 45005889 - 45005998
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattttg |
226 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
45005889 |
taaaatatggttttgatccctgcaaatatgtctcgttttgattttagtccctgcaaaaaaaaattgttgtttttggtccctgcaaatatgcctcattttg |
45005988 |
T |
 |
| Q |
227 |
gttttggtcc |
236 |
Q |
| |
|
|||||||||| |
|
|
| T |
45005989 |
gttttggtcc |
45005998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 123 - 236
Target Start/End: Original strand, 47005153 - 47005266
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| || |||||||||||||||||||||||| ||| | |
|
|
| T |
47005153 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttagttttagtccctgtaatttttttttgttgtttttggtccctgcaaatatgtctcgt |
47005252 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
||||||||| |||| |
|
|
| T |
47005253 |
tttggttttcgtcc |
47005266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 124 - 236
Target Start/End: Original strand, 15979338 - 15979450
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcatt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||| || |||||||||||||||||||||||| |||||| |
|
|
| T |
15979338 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaatatgtctcatt |
15979437 |
T |
 |
| Q |
224 |
ttggttttggtcc |
236 |
Q |
| |
|
||||||||||||| |
|
|
| T |
15979438 |
ttggttttggtcc |
15979450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 122 - 236
Target Start/End: Complemental strand, 9262157 - 9262042
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg-tnnnnnnnnnttattgtttttggtccctgcaaatatgcctc |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | || |||||||||||||||||||||||||||| |
|
|
| T |
9262157 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccccgcaaaaaaaaaattgttgtttttggtccctgcaaatatgcctc |
9262058 |
T |
 |
| Q |
221 |
attttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
9262057 |
attttggttttggtcc |
9262042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 124 - 235
Target Start/End: Original strand, 43441270 - 43441381
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcatt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||| || |||||||||||||||||||||||| |||||| |
|
|
| T |
43441270 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctgcaaaaaaattttgttgtttttggtccctgcaaatatgtctcatt |
43441369 |
T |
 |
| Q |
224 |
ttggttttggtc |
235 |
Q |
| |
|
|| ||||||||| |
|
|
| T |
43441370 |
ttagttttggtc |
43441381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 122 - 236
Target Start/End: Original strand, 9603627 - 9603741
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctca |
221 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| | || |||||||||||||||||||||||| || | |
|
|
| T |
9603627 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctataaaaaaaaattgttgtttttggtccctgcaaatatgtctta |
9603726 |
T |
 |
| Q |
222 |
ttttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
9603727 |
ttttggttttggtcc |
9603741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 118 - 236
Target Start/End: Original strand, 26089724 - 26089842
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgc |
217 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
26089724 |
atttttggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgt |
26089823 |
T |
 |
| Q |
218 |
ctcattttggttttggtcc |
236 |
Q |
| |
|
||| ||||||||||||||| |
|
|
| T |
26089824 |
ctctttttggttttggtcc |
26089842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 122 - 236
Target Start/End: Original strand, 45002019 - 45002133
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctca |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| || ||||||||||||||| |||||||| |||| |
|
|
| T |
45002019 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctgcaaaaaaaatttgttgtttttggtccctacaaatatgtctca |
45002118 |
T |
 |
| Q |
222 |
ttttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
45002119 |
ttttggttttggtcc |
45002133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 124 - 236
Target Start/End: Complemental strand, 40370589 - 40370476
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg-tnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||| | || |||||||||||||||||||||||||||||| |
|
|
| T |
40370589 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccccgcaaaaaaaaaattgttgtttttggtccctgcaaatatgcctcat |
40370490 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
40370489 |
tttggttttggtcc |
40370476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 119 - 212
Target Start/End: Complemental strand, 51550451 - 51550358
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
51550451 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaatttttttgttgtttttggtccctgcaaa |
51550358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 127 - 235
Target Start/End: Complemental strand, 40545836 - 40545728
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattttg |
226 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| ||||||||||||||||||| || |||||||||||| ||||||||||||||| ||||| |
|
|
| T |
40545836 |
taaaatatgattttggtccctgcaaatatgtctcattttggttttagtccctgtaattttttgtttttgtttttggtcactgcaaatatgcctcgttttg |
40545737 |
T |
 |
| Q |
227 |
gttttggtc |
235 |
Q |
| |
|
||||||||| |
|
|
| T |
40545736 |
gttttggtc |
40545728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 127 - 234
Target Start/End: Complemental strand, 8940522 - 8940415
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattttg |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||| || ||||||||| |||||||||||||| ||||||||| |
|
|
| T |
8940522 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaactttttgttgtttttgatccctgcaaatatgtctcattttg |
8940423 |
T |
 |
| Q |
227 |
gttttggt |
234 |
Q |
| |
|
|||||||| |
|
|
| T |
8940422 |
gttttggt |
8940415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 125 - 236
Target Start/End: Complemental strand, 11463480 - 11463369
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattt |
224 |
Q |
| |
|
||||||||||||||| |||| ||||||| ||| |||||||||||||||||| |||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
11463480 |
gctaaaatatggtttcggtcgctgcaaaaatgcctcgttttggttttagtctctgtaatttttttttgttgtttttggtccctgcaaatatgcctcattt |
11463381 |
T |
 |
| Q |
225 |
tggttttggtcc |
236 |
Q |
| |
|
|||||||||||| |
|
|
| T |
11463380 |
tggttttggtcc |
11463369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 121 - 236
Target Start/End: Complemental strand, 28452379 - 28452264
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctc |
220 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| || |||||||| ||||||||||||||| ||| |
|
|
| T |
28452379 |
ttaggctaaaatatggttttggtccctacaaatatgcttcgttttggttttagtccctgcaaaaaaaatttgttgtttttagtccctgcaaatatgtctc |
28452280 |
T |
 |
| Q |
221 |
attttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
28452279 |
attttggttttggtcc |
28452264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 117 - 236
Target Start/End: Original strand, 36672956 - 36673075
Alignment:
| Q |
117 |
gattttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatg |
216 |
Q |
| |
|
|||| |||| |||||||||||||||||| |||||||||||||| ||||||||||||||| |||| || |||||||||||||||||||||| | |
|
|
| T |
36672956 |
gattataggataaaatatggttttggtctctgcaaatatgtcttgttttggttttagtctctgtaatttttttttgttgtttttggtccctgcaaataag |
36673055 |
T |
 |
| Q |
217 |
cctcattttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
36673056 |
tctcattttggttttggtcc |
36673075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 122 - 236
Target Start/End: Complemental strand, 29490745 - 29490631
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctca |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| || |||||||||||| ||||||||| ||| |
|
|
| T |
29490745 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgtaattgttttttgctgtttttggtccttgcaaatatatctcg |
29490646 |
T |
 |
| Q |
222 |
ttttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
29490645 |
ttttggttttggtcc |
29490631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 122 - 212
Target Start/End: Complemental strand, 47336583 - 47336493
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
47336583 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
47336493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 123 - 236
Target Start/End: Complemental strand, 52342584 - 52342470
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnn-ttattgtttttggtccctgcaaatatgcctca |
221 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||| ||||||||||||||||||| ||| || ||||||||||||||||||||||||||||| |
|
|
| T |
52342584 |
aggctaaaatatggtttttgtctctgcaaatatgcctcgttttggttttagtccatgtaaaaaaaaaattgttgtttttggtccctgcaaatatgcctca |
52342485 |
T |
 |
| Q |
222 |
ttttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
52342484 |
ttttggttttggtcc |
52342470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 122 - 212
Target Start/End: Complemental strand, 54608865 - 54608775
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
54608865 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
54608775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 123 - 212
Target Start/End: Complemental strand, 12741272 - 12741183
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
12741272 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
12741183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 123 - 179
Target Start/End: Original strand, 474043 - 474099
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
474043 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
474099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 124 - 236
Target Start/End: Complemental strand, 7957226 - 7957115
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcatt |
223 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||| ||| || |
|
|
| T |
7957226 |
ggctaaaatatgattttggtccctgcaaatatgcgtcgttttggttttagtccctgt-aattttttttgttgtttttggtccctgcaaatatgtctcgtt |
7957128 |
T |
 |
| Q |
224 |
ttggttttggtcc |
236 |
Q |
| |
|
||||||||||||| |
|
|
| T |
7957127 |
ttggttttggtcc |
7957115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 120 - 238
Target Start/End: Complemental strand, 13514581 - 13514462
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnntt-attgtttttggtccctgcaaatatgcc |
218 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||||||||||||||||||| ||| || | ||||||||||| ||||||||||| |
|
|
| T |
13514581 |
tttaggctaaaatatgattttggtacctgcaaatatgtctcgttttggttttagtccatgtattttttttttggtagtttttggtccttgcaaatatgca |
13514482 |
T |
 |
| Q |
219 |
tcattttggttttggtcctt |
238 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
13514481 |
tcattttggttttggtcctt |
13514462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 120 - 180
Target Start/End: Complemental strand, 15979705 - 15979645
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
15979705 |
tttaggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctgt |
15979645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 124 - 180
Target Start/End: Complemental strand, 26090078 - 26090022
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26090078 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
26090022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 126 - 236
Target Start/End: Complemental strand, 2486900 - 2486790
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcatttt |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| ||| ||| |||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
2486900 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttaatccttgtaatttttttttattgtttttgatccctgcaaatatgcttcatttt |
2486801 |
T |
 |
| Q |
226 |
ggttttggtcc |
236 |
Q |
| |
|
|||||||||| |
|
|
| T |
2486800 |
agttttggtcc |
2486790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 121 - 235
Target Start/End: Complemental strand, 20405226 - 20405112
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctc |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | ||||| |||||||||||||| || ||||||||||||| ||||||||||||| |
|
|
| T |
20405226 |
ttaggctaaaatatggttttggtccctgcaaatatactttgttttagttttagtccctgtaaatttttgttgttgtttttggtccttgcaaatatgccta |
20405127 |
T |
 |
| Q |
221 |
attttggttttggtc |
235 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
20405126 |
attttggttttggtc |
20405112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 124 - 236
Target Start/End: Original strand, 19844265 - 19844378
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt-nnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||||| ||||||||||||| || |||||||||||||||| ||||||||||||| |
|
|
| T |
19844265 |
ggctaaaatatggttttggtccctacaaatatgcctcgttttaattttagtccctgtaaaaaaaaaattgttgtttttggtccctgtaaatatgcctcat |
19844364 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
19844365 |
tttggttttggtcc |
19844378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 119 - 236
Target Start/End: Original strand, 20644500 - 20644617
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcc |
218 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||||| ||||| ||||||||||||| | ||||||||| |||||||||||||| | |
|
|
| T |
20644500 |
tttttggctaaaatatagttttggtccctgcaaatatgtctcattttgattttagtccctgtaatttatttattttgtttttgatccctgcaaatatgtc |
20644599 |
T |
 |
| Q |
219 |
tcattttggttttggtcc |
236 |
Q |
| |
|
|| ||||||||||||||| |
|
|
| T |
20644600 |
tcgttttggttttggtcc |
20644617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 118 - 180
Target Start/End: Original strand, 22008520 - 22008582
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22008520 |
atttaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
22008582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 118 - 180
Target Start/End: Original strand, 22016038 - 22016100
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22016038 |
atttaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
22016100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 118 - 180
Target Start/End: Original strand, 30128278 - 30128340
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
30128278 |
attttaggctaaaatatggttttggtccctgcaaacatgtctcgttttggttttagttcctgt |
30128340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 123 - 212
Target Start/End: Original strand, 31480135 - 31480224
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
31480135 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
31480224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 118 - 180
Target Start/End: Complemental strand, 31869962 - 31869900
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
31869962 |
attttaggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtccctgt |
31869900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 119 - 236
Target Start/End: Original strand, 1721084 - 1721199
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcc |
218 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||||||| ||||||||||||||||||| || ||||||||| |||||||||||||| | |
|
|
| T |
1721084 |
ttttaggttaaaatatggttttggtccttgcaaatatgtctcattttggttttagtccctgt--aattttttttttgtttttgatccctgcaaatatgtc |
1721181 |
T |
 |
| Q |
219 |
tcattttggttttggtcc |
236 |
Q |
| |
|
|| |||| |||||||||| |
|
|
| T |
1721182 |
tcgttttagttttggtcc |
1721199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 25615974 - 25616031
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25615974 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
25616031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 127 - 180
Target Start/End: Complemental strand, 35569133 - 35569080
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35569133 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
35569080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 119 - 236
Target Start/End: Complemental strand, 39132911 - 39132795
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| || | ||||||| ||||||||| | |||||||||||||||||||||||| | |
|
|
| T |
39132911 |
ttttaggctaaaatatggttttggtccctgcaaatatgtttcatattggtttaagtccctgt-aatttttttcgttgtttttggtccctgcaaatatgtc |
39132813 |
T |
 |
| Q |
219 |
tcattttggttttggtcc |
236 |
Q |
| |
|
|| ||||||||||||||| |
|
|
| T |
39132812 |
tcgttttggttttggtcc |
39132795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 119 - 180
Target Start/End: Original strand, 40545559 - 40545620
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
40545559 |
ttttaggctaaaatatggttttggtccctgcaaatatgactcgttttagttttagtccctgt |
40545620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 122 - 234
Target Start/End: Complemental strand, 46622131 - 46622019
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctca |
221 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| || | ||||||||||||||||||||||| | |
|
|
| T |
46622131 |
taggctaaaatatggttttggtccttgcaaatatgtttcgttttggttttagtccctgaaattttttgttttagtttttggtccctgcaaatatgctacg |
46622032 |
T |
 |
| Q |
222 |
ttttggttttggt |
234 |
Q |
| |
|
||||||||||||| |
|
|
| T |
46622031 |
ttttggttttggt |
46622019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 124 - 212
Target Start/End: Original strand, 49323782 - 49323870
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
49323782 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
49323870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 3151744 - 3151804
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3151744 |
attttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
3151804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 119 - 179
Target Start/End: Original strand, 22155924 - 22155984
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
22155924 |
ttttaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
22155984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 123 - 179
Target Start/End: Original strand, 39436717 - 39436773
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39436717 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
39436773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 133 - 236
Target Start/End: Complemental strand, 52956691 - 52956588
Alignment:
| Q |
133 |
atggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattttggttttg |
232 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52956691 |
atggttttggtctctgcaaatatgcatcgttttggttttagtttttgtaaattttttttattgtttttggtccctgcaaatatgcctcattttggttttg |
52956592 |
T |
 |
| Q |
233 |
gtcc |
236 |
Q |
| |
|
|||| |
|
|
| T |
52956591 |
gtcc |
52956588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 124 - 180
Target Start/End: Complemental strand, 53701663 - 53701607
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53701663 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
53701607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 120 - 179
Target Start/End: Complemental strand, 3152115 - 3152056
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3152115 |
tttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
3152056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 125 - 236
Target Start/End: Complemental strand, 25610129 - 25610019
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| ||||||||| ||| || ||| |||||||||||||||||||| ||| ||| |
|
|
| T |
25610129 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccttgt-aaatttttttgttggttttggtccctgcaaatatgtctcgttt |
25610031 |
T |
 |
| Q |
225 |
tggttttggtcc |
236 |
Q |
| |
|
|||||||||||| |
|
|
| T |
25610030 |
tggttttggtcc |
25610019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 122 - 212
Target Start/End: Original strand, 28552019 - 28552109
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||| || |||||||||||||||||||| |
|
|
| T |
28552019 |
taggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccctgtaaaaaaattttgttgtttttggtccctgcaaa |
28552109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 123 - 217
Target Start/End: Original strand, 29686543 - 29686637
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgc |
217 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||| |||||||||||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
29686543 |
aggctagaatatggttttggtccatgcaaatatgtcttgttttggttttagtccctgtaatatttttttgttgtttttggtccctgcaaatatgc |
29686637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 121 - 176
Target Start/End: Original strand, 34238595 - 34238650
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34238595 |
ttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
34238650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 118 - 180
Target Start/End: Original strand, 4513257 - 4513319
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4513257 |
atttaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
4513319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 118 - 180
Target Start/End: Complemental strand, 4513626 - 4513564
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4513626 |
atttaaggctaaaatatggttttactccctgcaaatatgtctcgttttggttttagtccctgt |
4513564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 123 - 212
Target Start/End: Complemental strand, 19844582 - 19844493
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
19844582 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
19844493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 119 - 212
Target Start/End: Original strand, 28452142 - 28452235
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||| ||| || |||||||||||||||||||| |
|
|
| T |
28452142 |
ttttaggctaaaatatggttttggtccttgcaaatatgtcttgttttggttttagtccttgtaaaaaaaaattgttgtttttggtccctgcaaa |
28452235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 122 - 180
Target Start/End: Complemental strand, 30106222 - 30106164
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30106222 |
taggctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccctgt |
30106164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 122 - 180
Target Start/End: Original strand, 30130156 - 30130214
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30130156 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgt |
30130214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 121 - 179
Target Start/End: Original strand, 32119217 - 32119275
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32119217 |
ttaggctaaaatatagttttggtccctgcaaatatgtctcgttttagttttagtccctg |
32119275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 123 - 236
Target Start/End: Original strand, 40277821 - 40277934
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||||| ||||||| || |||||||||||||||| ||||||| ||| | |
|
|
| T |
40277821 |
aggctaaaatgtggttttggtccctgcaaatatgcttcgttttggttttactccctgtaattttttgtttttgtttttggtccctgaaaatatgtctcgt |
40277920 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||| ||||||||| |
|
|
| T |
40277921 |
tttgattttggtcc |
40277934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 123 - 212
Target Start/End: Complemental strand, 45002386 - 45002297
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
45002386 |
aggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
45002297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 119 - 212
Target Start/End: Complemental strand, 47005524 - 47005431
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| || |||||||||||||||||||| |
|
|
| T |
47005524 |
ttttaggctaaaatatggttttggtccctgcaaatattcctcgttttggttttagtccttgtaaattttttttgttgtttttggtccctgcaaa |
47005431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 1721453 - 1721396
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1721453 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgt |
1721396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 4950036 - 4950093
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4950036 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
4950093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 124 - 212
Target Start/End: Original strand, 9261789 - 9261877
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
9261789 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaacaaatttgttgtttttggtccctgcaaa |
9261877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 119 - 180
Target Start/End: Complemental strand, 21159822 - 21159761
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
21159822 |
ttttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt |
21159761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 122 - 179
Target Start/End: Original strand, 28427243 - 28427300
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
28427243 |
taggctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagtccctg |
28427300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 235
Target Start/End: Original strand, 35177254 - 35177366
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||| |||| | ||||||||||||| || ||||||| ||| | |
|
|
| T |
35177254 |
aggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtttctgtaattttttttcgttgtttttggtccttgtaaatatgtctcgt |
35177353 |
T |
 |
| Q |
223 |
tttggttttggtc |
235 |
Q |
| |
|
||||||||||||| |
|
|
| T |
35177354 |
tttggttttggtc |
35177366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 122 - 179
Target Start/End: Original strand, 37506865 - 37506922
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
37506865 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
37506922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 118 - 175
Target Start/End: Original strand, 39288567 - 39288624
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
175 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
39288567 |
atttaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
39288624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 48924241 - 48924184
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
48924241 |
aggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtccctgt |
48924184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 120 - 176
Target Start/End: Complemental strand, 3830520 - 3830464
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3830520 |
tttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
3830464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 20612899 - 20612843
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
20612899 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
20612843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 124 - 180
Target Start/End: Complemental strand, 25710870 - 25710814
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25710870 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
25710814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 28427609 - 28427553
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
28427609 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
28427553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 37507223 - 37507167
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
37507223 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
37507167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 39437110 - 39437054
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
39437110 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
39437054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 119 - 179
Target Start/End: Complemental strand, 40169659 - 40169599
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40169659 |
tttttggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
40169599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 43441604 - 43441548
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
43441604 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg |
43441548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 123 - 175
Target Start/End: Original strand, 47114486 - 47114538
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
175 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47114486 |
aggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtc |
47114538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 123 - 179
Target Start/End: Original strand, 51834607 - 51834663
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
51834607 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
51834663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 119 - 179
Target Start/End: Complemental strand, 51834947 - 51834887
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
51834947 |
ttttaggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
51834887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 118 - 212
Target Start/End: Original strand, 863275 - 863369
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||||||||||||||| ||||||||| |||| || |||||||||||||||||||| |
|
|
| T |
863275 |
attttaggctaaaatatgattttggtccatgcaaatatgtctcgttttagttttagtctctgtaaaaaaaaattgttgtttttggtccctgcaaa |
863369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 121 - 180
Target Start/End: Original strand, 3830131 - 3830190
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
3830131 |
ttaggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgt |
3830190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 124 - 179
Target Start/End: Original strand, 10976978 - 10977033
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
10976978 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
10977033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 125 - 180
Target Start/End: Original strand, 11463233 - 11463288
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11463233 |
gctaaaatatggttttggttcctgcaaatatgcctcgttttggttttagtccctgt |
11463288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 121 - 180
Target Start/End: Original strand, 25710507 - 25710566
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
25710507 |
ttaggctcaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt |
25710566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 120 - 179
Target Start/End: Complemental strand, 39288902 - 39288843
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
39288902 |
tttaggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
39288843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 127 - 236
Target Start/End: Complemental strand, 8555305 - 8555196
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattttg |
226 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||||||||||||| ||| || ||||||||| |||||||||||||| || ||||| |
|
|
| T |
8555305 |
taaaatatggttttggtccatgcaaatatgcatcgttttggttttagtccttgtaatatttttttgttgtttttgatccctgcaaatatgtcttgttttg |
8555206 |
T |
 |
| Q |
227 |
gttttggtcc |
236 |
Q |
| |
|
|||||||||| |
|
|
| T |
8555205 |
gttttggtcc |
8555196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 123 - 177
Target Start/End: Original strand, 14772210 - 14772264
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
14772210 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccc |
14772264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 125 - 179
Target Start/End: Complemental strand, 22156292 - 22156238
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
22156292 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
22156238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 122 - 176
Target Start/End: Complemental strand, 29446208 - 29446154
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
29446208 |
taggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtcc |
29446154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 118 - 180
Target Start/End: Complemental strand, 29955672 - 29955610
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
29955672 |
attttaggcttaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt |
29955610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 118 - 180
Target Start/End: Complemental strand, 30004827 - 30004765
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
30004827 |
attttaggcttaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt |
30004765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 122 - 180
Target Start/End: Complemental strand, 35407792 - 35407734
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
35407792 |
taggctaaaatatggttttgatccctgcaaatatgtcttgtttttgttttagtccctgt |
35407734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 126 - 180
Target Start/End: Original strand, 50196301 - 50196355
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
50196301 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
50196355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 118 - 172
Target Start/End: Original strand, 52342189 - 52342243
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
52342189 |
attttaggctaaaatatggttttggtccctgcaaatatgcctccttttggtttta |
52342243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 176
Target Start/End: Complemental strand, 3387605 - 3387552
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
3387605 |
aggctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagtcc |
3387552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 127 - 180
Target Start/End: Complemental strand, 4322186 - 4322133
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
4322186 |
taaaatatagttttggtccctgcaaatatgtcttgttttggttttagtccctgt |
4322133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 172
Target Start/End: Original strand, 4814539 - 4814588
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
172 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
4814539 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
4814588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 5345690 - 5345633
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5345690 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgt |
5345633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 119 - 180
Target Start/End: Original strand, 16123134 - 16123195
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||| ||||||||||||||||| ||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
16123134 |
tttttggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctgt |
16123195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 176
Target Start/End: Original strand, 21159452 - 21159505
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
21159452 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc |
21159505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 21553888 - 21553945
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| ||||||| |||||| |
|
|
| T |
21553888 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagcccctgt |
21553945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 176
Target Start/End: Original strand, 29525104 - 29525157
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
29525104 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtcc |
29525157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 30268504 - 30268561
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30268504 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt |
30268561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 176
Target Start/End: Original strand, 38232240 - 38232293
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
38232240 |
aggctaaaatatgattttggtccctgcaaatatgtctcgttttgattttagtcc |
38232293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 124 - 212
Target Start/End: Original strand, 40370285 - 40370373
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| |||||||| ||||| || |||||||||||||||||||| |
|
|
| T |
40370285 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttagttttagttcctgtaaaaaaaaattgttgtttttggtccctgcaaa |
40370373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 45320980 - 45320923
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45320980 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt |
45320923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 51759818 - 51759875
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||| | || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
51759818 |
aggctaaaatatggttctagttcctgcaaatatgtctcgttttggttttagtccctgt |
51759875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 124 - 180
Target Start/End: Complemental strand, 4035053 - 4034997
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| |||||||| ||||| |
|
|
| T |
4035053 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagttcctgt |
4034997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 124 - 180
Target Start/End: Complemental strand, 9863404 - 9863348
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9863404 |
ggctaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgt |
9863348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 13584368 - 13584312
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
13584368 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
13584312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 14633890 - 14633834
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
14633890 |
aggctaaattatggttttagtccctgcaaatatgtcttgttttggttttagtccctg |
14633834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 124 - 180
Target Start/End: Original strand, 15016388 - 15016444
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
15016388 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgt |
15016444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 123 - 179
Target Start/End: Original strand, 26799887 - 26799943
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
26799887 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
26799943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 28942906 - 28942850
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| |||||||||||||||||||||| |
|
|
| T |
28942906 |
aggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctg |
28942850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 124 - 180
Target Start/End: Original strand, 29445954 - 29446010
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29445954 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt |
29446010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 124 - 235
Target Start/End: Complemental strand, 29678387 - 29678276
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcatt |
223 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| | ||||||||||||| |||| | || ||||||||||||||| ||||||||||| || |
|
|
| T |
29678387 |
ggctaaaatatgattttggtccctgcaaatatgccctgttttggttttagcccctttaattttttttttttgtttttggtccctataaatatgcctcgtt |
29678288 |
T |
 |
| Q |
224 |
ttggttttggtc |
235 |
Q |
| |
|
|||||||||||| |
|
|
| T |
29678287 |
ttggttttggtc |
29678276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 30552479 - 30552423
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||| ||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
30552479 |
aggctaaaatatcgttttagtccatgcaaatatgtctcgttttggttttagtccctg |
30552423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 123 - 179
Target Start/End: Original strand, 40169343 - 40169399
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40169343 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttgattttagtccctg |
40169399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 124 - 180
Target Start/End: Complemental strand, 45313863 - 45313807
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
45313863 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttgattttagtccctgt |
45313807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 51500686 - 51500630
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
51500686 |
aggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagtccctg |
51500630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 123 - 171
Target Start/End: Original strand, 53113442 - 53113490
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttt |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
53113442 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttgttttt |
53113490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 4814899 - 4814845
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
4814899 |
aggctaaaatatggttttagtcc-tgcaaatatgtctcgttttggttttagtccct |
4814845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 124 - 179
Target Start/End: Original strand, 8510214 - 8510269
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
8510214 |
ggctaaaatatggttttagtccctgcaaatatgcctctttttggttttagtccctg |
8510269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 122 - 212
Target Start/End: Complemental strand, 9603921 - 9603831
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||||||||| || |||| || |||||||||||||||||||| |
|
|
| T |
9603921 |
taggctaaaatatggttttggtccctgcaaatatgcctcattttggttttattctctgtaaaagaaatttgttgtttttggtccctgcaaa |
9603831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 125 - 180
Target Start/End: Complemental strand, 28418899 - 28418844
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | |||||| ||||||||||||| |
|
|
| T |
28418899 |
gctaaaatatggttttggtccctgcaaatatgttttgttttgattttagtccctgt |
28418844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 43440494 - 43440549
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
43440494 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccct |
43440549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 118 - 180
Target Start/End: Original strand, 4321940 - 4322002
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||| || ||| |||||||||||||| ||||||||||| ||||||| |
|
|
| T |
4321940 |
attttaggctaaaatatggttctgatccttgcaaatatgtctcattttggttttaatccctgt |
4322002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 122 - 180
Target Start/End: Original strand, 7588316 - 7588374
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| || ||||||||||||||| |||| |
|
|
| T |
7588316 |
taggctaaaatatagttttggtccctgcaaatatgccttgttttggttttagtctctgt |
7588374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 121 - 179
Target Start/End: Complemental strand, 8510532 - 8510474
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||| | ||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8510532 |
ttaggcaacaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctg |
8510474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 122 - 180
Target Start/End: Complemental strand, 27681684 - 27681626
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
27681684 |
taggctaaaatatggttctggtctctgcaaatatgcctcgttttggttttaatccctgt |
27681626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 126 - 180
Target Start/End: Original strand, 29955300 - 29955354
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
29955300 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgt |
29955354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 126 - 180
Target Start/End: Original strand, 30004454 - 30004508
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
30004454 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgt |
30004508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #151
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 126 - 180
Target Start/End: Original strand, 31869596 - 31869650
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
31869596 |
ctaaaatatggttttaattcctgcaaatatgtctcgttttggttttagtccctgt |
31869650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #152
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 122 - 180
Target Start/End: Complemental strand, 50196659 - 50196601
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||| |||||||| |||||||||||||| |
|
|
| T |
50196659 |
taggctaaaatatggttttagtccctacaaatatgcctcgtttttgttttagtccctgt |
50196601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #153
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 122 - 179
Target Start/End: Original strand, 275442 - 275499
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||| ||||||||| |||||||||||| |
|
|
| T |
275442 |
taggctaaaatatggttttagtccctgcaactatgcctcgttttgattttagtccctg |
275499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #154
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 121 - 174
Target Start/End: Complemental strand, 7518449 - 7518396
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
174 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7518449 |
ttagactaaaatatggttttactccctgcaaatatgtctcgttttggttttagt |
7518396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #155
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 12673643 - 12673700
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||| ||||| ||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
12673643 |
aggctaaaatatagttttagtccctgtaaatatgcctcgttttggttttagtccctgt |
12673700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #156
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 126 - 179
Target Start/End: Original strand, 14633547 - 14633600
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
14633547 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaggccctg |
14633600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #157
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 134 - 179
Target Start/End: Complemental strand, 25610061 - 25610016
Alignment:
| Q |
134 |
tggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
25610061 |
tggttttggtccctgcaaatatgtctcgttttggttttggtccctg |
25610016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #158
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 29678023 - 29678080
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
29678023 |
aggctaaaatatagttttggtctttgcaaatatgcctcgttttggttttagtccctgt |
29678080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #159
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 40979711 - 40979654
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
40979711 |
aggctaaaatatggttttaatccctgcaaatatggctcgttttggttttaatccctgt |
40979654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #160
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 127 - 180
Target Start/End: Original strand, 45161116 - 45161169
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45161116 |
taaaatatggtttaagtccctgcaaatatgtctcgttttggttttagtctctgt |
45161169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #161
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 46186772 - 46186715
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| |||||||||||||||||| |||| |
|
|
| T |
46186772 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtctctgt |
46186715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #162
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 123 - 176
Target Start/End: Original strand, 46751270 - 46751323
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
46751270 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtcc |
46751323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #163
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 127 - 180
Target Start/End: Complemental strand, 54767524 - 54767471
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
54767524 |
taaaatatggttttggtccctagaaatatgtctcgttttgattttagtccctgt |
54767471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #164
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 10977342 - 10977286
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
10977342 |
aggctaaaatatggatttaatccctgcaaatatgcctcgttttggttttagtccctg |
10977286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #165
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 123 - 175
Target Start/End: Original strand, 20611019 - 20611071
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
175 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
20611019 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
20611071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #166
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 122 - 174
Target Start/End: Original strand, 28942523 - 28942575
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
174 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| || |||||||||||||| |
|
|
| T |
28942523 |
taggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagt |
28942575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #167
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 124 - 180
Target Start/End: Original strand, 30424628 - 30424684
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||||| ||||||||| |||| |
|
|
| T |
30424628 |
ggctaaaatatggttttagtccctgcaaatatgtcttgttttagttttagtctctgt |
30424684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #168
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 123 - 179
Target Start/End: Original strand, 34582523 - 34582579
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34582523 |
aggctaaaatatggcattggtccctgcaaatatgtccagttttggttttagtccctg |
34582579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #169
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 124 - 180
Target Start/End: Original strand, 44802282 - 44802338
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
44802282 |
ggctaaaatatggttttagtccctgcaaatatgcgtcgttttggttttagttcctgt |
44802338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #170
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 122 - 174
Target Start/End: Original strand, 46901102 - 46901154
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
174 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||| |||||||||||||||| |
|
|
| T |
46901102 |
taggctaaaatatggttttagtctctgcaaatatgtatcgttttggttttagt |
46901154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #171
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 125 - 180
Target Start/End: Original strand, 9596759 - 9596814
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
9596759 |
gctaaaatatggtttttgtctctgcaaatatgcatcgttttggttttagtccctgt |
9596814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #172
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 127 - 178
Target Start/End: Original strand, 20757403 - 20757454
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
||||||||| |||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
20757403 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccct |
20757454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #173
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 193 - 236
Target Start/End: Complemental strand, 22016339 - 22016296
Alignment:
| Q |
193 |
ttgtttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
22016339 |
ttgtttttggtccctgcaaatatgtctcattttggttttggtcc |
22016296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #174
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 121 - 180
Target Start/End: Original strand, 25609764 - 25609823
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||||||| | |||||| | ||||||||||||||||||||||| |
|
|
| T |
25609764 |
ttaggctaaaatatggttttggtctttacaaataagcctcgttttggttttagtccctgt |
25609823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #175
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 126 - 173
Target Start/End: Original strand, 35533281 - 35533328
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttag |
173 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
35533281 |
ctaaaatatggttttggtctctgcaaatatgtcttgttttggttttag |
35533328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #176
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 126 - 212
Target Start/End: Complemental strand, 45006247 - 45006161
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
||||||||| ||||| ||||||||||||||| ||||||||||||||| ||||||| || |||||||||||||||||||| |
|
|
| T |
45006247 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttaatccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
45006161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #177
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 126 - 212
Target Start/End: Original strand, 46724545 - 46724631
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
|||||||||| ||||| ||| ||||||||| ||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
46724545 |
ctaaaatatgattttgatccttgcaaatatatctcgttttagttttagtccctgtaaaaaaaaattattgtttttggtccctgcaaa |
46724631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #178
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 125 - 175
Target Start/End: Complemental strand, 3361817 - 3361767
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
175 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| || ||||||||||||||| |
|
|
| T |
3361817 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtc |
3361767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #179
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 7957154 - 7957112
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7957154 |
ttttggtccctgcaaatatgtctcgttttggttttggtccctg |
7957112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #180
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 127 - 212
Target Start/End: Original strand, 8940163 - 8940248
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
||||||||||||||| || |||||||||| ||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
8940163 |
taaaatatggttttgatctctgcaaatatacctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
8940248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #181
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 130 - 180
Target Start/End: Complemental strand, 38232594 - 38232544
Alignment:
| Q |
130 |
aatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| |||| |||| |
|
|
| T |
38232594 |
aatatggttttggtacctgcaaatatgtctcgttttggtttcagtctctgt |
38232544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #182
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 39132834 - 39132792
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
39132834 |
ttttggtccctgcaaatatgtctcgttttggttttggtccctg |
39132792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #183
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 125 - 226
Target Start/End: Complemental strand, 46724901 - 46724800
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattt |
224 |
Q |
| |
|
||||||||||||||||| || |||||||||||| | |||||| ||||||||||||| || ||||||||||||| |||||||||| ||| ||| |
|
|
| T |
46724901 |
gctaaaatatggttttgatctctgcaaatatgttttgttttgattttagtccctgtaattttttttttttgtttttggtccttgcaaatatgtctcgttt |
46724802 |
T |
 |
| Q |
225 |
tg |
226 |
Q |
| |
|
|| |
|
|
| T |
46724801 |
tg |
46724800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #184
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 123 - 176
Target Start/End: Original strand, 7518089 - 7518142
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||||||| || ||||||||||||||| |||||||| |||||||||| |
|
|
| T |
7518089 |
aggctaaaatatggtgttagtccctgcaaatatgcctcgtttttgttttagtcc |
7518142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #185
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 124 - 180
Target Start/End: Original strand, 18175791 - 18175845
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
18175791 |
ggctaaaatatggttttagtccctgcaaatatgtctcg--ttggttttaatccctgt |
18175845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #186
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 116 - 212
Target Start/End: Complemental strand, 19297957 - 19297861
Alignment:
| Q |
116 |
tgattttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
|||| |||| ||||||||| |||||||||| || ||||||||||||||||| |||||||| |||| || |||||||||||||||||||| |
|
|
| T |
19297957 |
tgatattagactaaaatatagttttggtccttgtaaatatgtctcgttttgtttttagtctctgtaaatttttgttgttgtttttggtccctgcaaa |
19297861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #187
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 123 - 176
Target Start/End: Original strand, 19656540 - 19656593
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
19656540 |
aggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagtcc |
19656593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #188
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 20644877 - 20644820
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| | ||||||| ||||||||||||| |
|
|
| T |
20644877 |
aggctaaaatatggttttggtccctgtaaatataccccgttttgattttagtccctgt |
20644820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #189
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 123 - 176
Target Start/End: Complemental strand, 34238916 - 34238863
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||| |||||||||||||||||| |
|
|
| T |
34238916 |
aggctaaaatatggttttagtccccgcaaatatgcttcgttttggttttagtcc |
34238863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #190
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 125 - 174
Target Start/End: Complemental strand, 36673244 - 36673195
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
36673244 |
gctaaaatatggttttggtccctgcaaatatgacttattttggttttagt |
36673195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #191
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 127 - 234
Target Start/End: Original strand, 36732643 - 36732748
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattttg |
226 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| ||||||||||||| |||| | |||||||||||||||| | ||||| ||||||||| |
|
|
| T |
36732643 |
taaaataaggttttggtccctgcaaatatgtcttattttggttttagtttctgtaaaaaaaatt--ttgtttttggtccctgtagatatgtctcattttg |
36732740 |
T |
 |
| Q |
227 |
gttttggt |
234 |
Q |
| |
|
|||||||| |
|
|
| T |
36732741 |
gttttggt |
36732748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #192
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 123 - 168
Target Start/End: Complemental strand, 44802549 - 44802504
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
168 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
44802549 |
aggctaaaatatgattttgatccctgcaaatatgtctcgttttggt |
44802504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #193
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 125 - 178
Target Start/End: Original strand, 50008921 - 50008974
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
50008921 |
gctagaatatggttttggtccctgcaaatatgttttattttggttttagtccct |
50008974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #194
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 118 - 179
Target Start/End: Complemental strand, 52403189 - 52403128
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| | |||| |||||| ||||||| |
|
|
| T |
52403189 |
attttaggctaaaatatgcttttggtccctgcaaatatggcgagtttgggttttggtccctg |
52403128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #195
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 126 - 174
Target Start/End: Original strand, 2486581 - 2486629
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
174 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||| ||||||||||||| |
|
|
| T |
2486581 |
ctaaaatatggtttttgtccctgcaaatatgactcattttggttttagt |
2486629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #196
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 122 - 178
Target Start/End: Original strand, 9863045 - 9863100
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
|||| |||||||||||||| |||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
9863045 |
taggttaaaatatggttttagtccctgcaa-tatgcctcgttttggttttagtccct |
9863100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #197
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 123 - 175
Target Start/End: Original strand, 15286155 - 15286207
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
175 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
15286155 |
aggctaaaatatggttttaatccctgcaaatatgcttcgttttggttttagtc |
15286207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #198
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 124 - 180
Target Start/End: Complemental strand, 39072213 - 39072157
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||||||||| ||||| ||||||| |
|
|
| T |
39072213 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttgattttaatccctgt |
39072157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #199
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 124 - 179
Target Start/End: Complemental strand, 49670803 - 49670747
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccc-tgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
49670803 |
ggctaaaatatggttttagtcccctgcaaatatgcttcgttttggttttagtccctg |
49670747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #200
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 124 - 180
Target Start/End: Complemental strand, 50009284 - 50009228
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||| |||||||||||||| |||||||||| ||||||||| ||||| ||||||| |
|
|
| T |
50009284 |
ggctaaactatggttttggtccttgcaaatatgcctcgttttgattttaatccctgt |
50009228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #201
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 124 - 180
Target Start/End: Complemental strand, 50261936 - 50261880
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||| || |||||||||||||| |||| |
|
|
| T |
50261936 |
ggctaaaatatcgttttagtccctgcaaatatgtttcattttggttttagtctctgt |
50261880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #202
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 125 - 173
Target Start/End: Complemental strand, 51760117 - 51760069
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttag |
173 |
Q |
| |
|
|||||||||||||| | ||||||||||||||| |||||||||||||||| |
|
|
| T |
51760117 |
gctaaaatatggttctagtccctgcaaatatgcctcgttttggttttag |
51760069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #203
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 19844568 - 19844529
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
19844568 |
ttttggtccctgcaaatatgcctcattttggttttagtcc |
19844529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #204
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 126 - 212
Target Start/End: Original strand, 30034109 - 30034195
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||||||||||| ||| ||| || |||||||||||||||||||| |
|
|
| T |
30034109 |
ctaaaatatggttttggtccttgtaaatatgcctcgttttggttttaatccttgtaaaaaaaaattgttgtttttggtccctgcaaa |
30034195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #205
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 123 - 174
Target Start/End: Complemental strand, 40279336 - 40279285
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
174 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |||||| ||||||| |
|
|
| T |
40279336 |
aggctaaaatatggttttggtctttgcaaatatgtcttgttttgtttttagt |
40279285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #206
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 125 - 176
Target Start/End: Original strand, 46186410 - 46186461
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
46186410 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtcc |
46186461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #207
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 474335 - 474293
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
474335 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
474293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #208
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 863579 - 863537
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
863579 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
863537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #209
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 197 - 231
Target Start/End: Complemental strand, 9603906 - 9603872
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggtttt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
9603906 |
ttttggtccctgcaaatatgcctcattttggtttt |
9603872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #210
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 12740980 - 12741022
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
12740980 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
12741022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #211
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 15979411 - 15979453
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
15979411 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
15979453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #212
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 20644578 - 20644620
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
20644578 |
ttttgatccctgcaaatatgtctcgttttggttttggtccctg |
20644620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #213
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 122 - 180
Target Start/End: Complemental strand, 20907459 - 20907401
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||| ||| |||||||||||||| |||| |
|
|
| T |
20907459 |
taggttaaaatatggttttaatccctgcaaatatgcctcattttggttttagtctctgt |
20907401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #214
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 22008817 - 22008775
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
22008817 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
22008775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #215
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 22016335 - 22016293
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
22016335 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
22016293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #216
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 26089803 - 26089845
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
26089803 |
ttttggtccctgcaaatatgtctctttttggttttggtccctg |
26089845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #217
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 28552310 - 28552268
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
28552310 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
28552268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #218
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 31480427 - 31480385
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
31480427 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
31480385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #219
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 32119511 - 32119469
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
32119511 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
32119469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #220
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 122 - 180
Target Start/End: Original strand, 35498414 - 35498472
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||| ||| |||||| |||||||| |||||||||||||| ||||||| |
|
|
| T |
35498414 |
taggctaaaatatgggtttagtccctacaaatatgattcgttttggttttaatccctgt |
35498472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #221
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 123 - 177
Target Start/End: Original strand, 35936779 - 35936833
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
177 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||||||||||||| |||| |
|
|
| T |
35936779 |
aggctaaaatatggttttggtccctacaaatatacttcgttttggttttaatccc |
35936833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #222
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 126 - 176
Target Start/End: Complemental strand, 43440785 - 43440735
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||| |||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
43440785 |
ctaaaatataattttagtccctgcaaatatgcctcgttttggttttagtcc |
43440735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #223
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 118 - 180
Target Start/End: Complemental strand, 45521842 - 45521780
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||| ||| |||||||||||||| ||| ||||||||||| |||||||||||||||| ||||| |
|
|
| T |
45521842 |
atttaaggttaaaatatggttttagtctttgcaaatatgtttcgttttggttttagttcctgt |
45521780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #224
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 122 - 180
Target Start/End: Complemental strand, 47114805 - 47114747
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||| | ||||||| |||||||| ||||| |
|
|
| T |
47114805 |
taggctaaaatatagttttggtccttgcaaatatatttcgttttagttttagttcctgt |
47114747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #225
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 121 - 155
Target Start/End: Complemental strand, 47433871 - 47433837
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatat |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
47433871 |
ttaggctaaaatatggttttggtccctgcaaatat |
47433837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #226
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 49324073 - 49324031
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
49324073 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
49324031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #227
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 124 - 174
Target Start/End: Original strand, 52956383 - 52956433
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
174 |
Q |
| |
|
||||||||||| ||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
52956383 |
ggctaaaatatacttttggtccctactaatatgtctcgttttggttttagt |
52956433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #228
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 54608591 - 54608633
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
54608591 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
54608633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #229
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 16679963 - 16679906
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||| |||| |||||||||||||||| |||||| ||||| ||||| ||||||| |
|
|
| T |
16679963 |
aggctaaaagatggctttggtccctgcaaatttgtctcattttgattttaatccctgt |
16679906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #230
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 121 - 174
Target Start/End: Original strand, 20404887 - 20404940
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
174 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||| |||||| |||||||||| |
|
|
| T |
20404887 |
ttaggctaaaatatggttttgcttcctgcaaatatacctcgttatggttttagt |
20404940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #231
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 119 - 180
Target Start/End: Complemental strand, 20757780 - 20757719
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| |||| |||||| ||||||| ||||||||||||||||| |||| |
|
|
| T |
20757780 |
ttttaggctaaaatatgattttaatccctgtaaatatgcatcgttttggttttagtctctgt |
20757719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #232
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 123 - 176
Target Start/End: Complemental strand, 30130505 - 30130452
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||| |||||||||||| ||| ||||||||||| ||| ||||||||||||||| |
|
|
| T |
30130505 |
aggctcaaatatggttttagtcactgcaaatatgcctcattttggttttagtcc |
30130452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #233
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 124 - 177
Target Start/End: Complemental strand, 30426226 - 30426174
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
177 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| ||||||||| |||||||||| |
|
|
| T |
30426226 |
ggctaaaatatggttttagtcc-tgcaaatatgcctcgttttgattttagtccc |
30426174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #234
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 121 - 178
Target Start/End: Original strand, 30552144 - 30552200
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
||||| |||||||||||||| | || ||||||||||||| |||||||||||||||||| |
|
|
| T |
30552144 |
ttaggttaaaatatggttttagacc-tgcaaatatgtcttgttttggttttagtccct |
30552200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #235
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 122 - 155
Target Start/End: Complemental strand, 39820665 - 39820632
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatat |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
39820665 |
taggctaaaatatggttttggtccctgcaaatat |
39820632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #236
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 119 - 180
Target Start/End: Complemental strand, 47902150 - 47902089
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||| ||||||||||| ||||| ||||| ||||||||| | |||||||||||||||||||| |
|
|
| T |
47902150 |
tttttggctaaaatatagttttagtccccgcaaatatgcattgttttggttttagtccctgt |
47902089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #237
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 122 - 175
Target Start/End: Original strand, 51500396 - 51500449
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
175 |
Q |
| |
|
||||||||||||||||| | ||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
51500396 |
taggctaaaatatggttctagtctctgtaaatatgcctcgttttggttttagtc |
51500449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #238
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 118 - 179
Target Start/End: Original strand, 53121296 - 53121357
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||| | |||| |||||||||||||| |
|
|
| T |
53121296 |
atttaaggctaaaatatgtttttggtccctgcaaatatagcgagtttgggttttagtccctg |
53121357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #239
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 11312569 - 11312513
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
11312569 |
aggctaaaatatggcattggtccatgcaaatatgttcagttttggttttagtccctg |
11312513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #240
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 132 - 180
Target Start/End: Original strand, 29490377 - 29490425
Alignment:
| Q |
132 |
tatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
29490377 |
tatggttttggtccctacaaatatgcaccgttttggttttagtccctgt |
29490425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #241
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 119 - 155
Target Start/End: Original strand, 46026071 - 46026107
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatat |
155 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
46026071 |
ttttaggctaaaatatgtttttggtccctgcaaatat |
46026107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #242
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 123 - 179
Target Start/End: Original strand, 52401016 - 52401072
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| | |||| |||||| ||||||| |
|
|
| T |
52401016 |
aggctaaaatatgtttttggtccctgcaaatatggcgagtttgggttttggtccctg |
52401072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #243
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Original strand, 3830147 - 3830186
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
3830147 |
ttttagtccctgcaaatatgcctcattttggttttagtcc |
3830186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #244
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 8940512 - 8940473
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
8940512 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
8940473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #245
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Original strand, 9261802 - 9261841
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
9261802 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
9261841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #246
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 121 - 180
Target Start/End: Complemental strand, 14772528 - 14772469
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||| ||||||||||||||| || | ||||||||| ||| ||||||||||||||||||| |
|
|
| T |
14772528 |
ttagactaaaatatggttttagtacatgcaaatatacctcattttggttttagtccctgt |
14772469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #247
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 145 - 180
Target Start/End: Original strand, 20907158 - 20907193
Alignment:
| Q |
145 |
cctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |
|
|
| T |
20907158 |
cctgtaaatatgtctcgttttggttttagtccctgt |
20907193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #248
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 123 - 166
Target Start/End: Original strand, 25353198 - 25353241
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttg |
166 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
25353198 |
aggctagaatatggttttagtccctgcaaatatgcctcgttttg |
25353241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #249
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Original strand, 25615988 - 25616027
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
25615988 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
25616027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #250
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 124 - 155
Target Start/End: Original strand, 27681326 - 27681357
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatat |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
27681326 |
ggctaaaatatggttttggtccctgcaaatat |
27681357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #251
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 124 - 175
Target Start/End: Complemental strand, 29686870 - 29686819
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
175 |
Q |
| |
|
||||||||||| |||||| ||||||||||| || ||||||||||||||||| |
|
|
| T |
29686870 |
ggctaaaatatagttttgatccctgcaaatgtgcatcgttttggttttagtc |
29686819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #252
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Original strand, 31480149 - 31480188
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
31480149 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
31480188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #253
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 124 - 175
Target Start/End: Complemental strand, 35533618 - 35533567
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
175 |
Q |
| |
|
|||||||||||| ||||| ||||| || ||||||||||||||| |||||||| |
|
|
| T |
35533618 |
ggctaaaatatgattttgctccctacacatatgtctcgttttgattttagtc |
35533567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #254
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 145 - 180
Target Start/End: Original strand, 39132563 - 39132598
Alignment:
| Q |
145 |
cctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |
|
|
| T |
39132563 |
cctgcaaatatgtttcgttttggttttagtccctgt |
39132598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #255
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 40545826 - 40545787
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
40545826 |
ttttggtccctgcaaatatgtctcattttggttttagtcc |
40545787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #256
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Original strand, 49323795 - 49323834
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
49323795 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
49323834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #257
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Original strand, 51550095 - 51550134
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
51550095 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
51550134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #258
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 124 - 174
Target Start/End: Complemental strand, 275833 - 275783
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
174 |
Q |
| |
|
|||||||||||| |||| ||||||| ||||||| |||||||||||||||| |
|
|
| T |
275833 |
ggctaaaatatgattttagtccctgtaaatatgcttcgttttggttttagt |
275783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #259
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 1721160 - 1721202
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
1721160 |
ttttgatccctgcaaatatgtctcgttttagttttggtccctg |
1721202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #260
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 3387338 - 3387380
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||||| |
|
|
| T |
3387338 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
3387380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #261
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 4034790 - 4034832
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||||| |
|
|
| T |
4034790 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
4034832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #262
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 8555235 - 8555193
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
8555235 |
ttttgatccctgcaaatatgtcttgttttggttttggtccctg |
8555193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #263
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 9262081 - 9262039
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||||| |
|
|
| T |
9262081 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
9262039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #264
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 9603702 - 9603744
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
9603702 |
ttttggtccctgcaaatatgtcttattttggttttggtccctg |
9603744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #265
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 125 - 179
Target Start/End: Complemental strand, 20489416 - 20489362
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||| |||||||||||||||||||| | |||| |||||| ||||||| |
|
|
| T |
20489416 |
gctaaaatatgtttttggtccctgcaaatatgacgagtttgggttttggtccctg |
20489362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #266
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 27681390 - 27681432
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||| ||||||| |
|
|
| T |
27681390 |
ttttggtccctgcaaatacgtctcgttttgattttggtccctg |
27681432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #267
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 175
Target Start/End: Original strand, 35565581 - 35565619
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtc |
175 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
35565581 |
ttttggtccctgcaaatatgcctcattttggttttagtc |
35565619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #268
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 36673036 - 36673078
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||| ||||||| |
|
|
| T |
36673036 |
ttttggtccctgcaaataagtctcattttggttttggtccctg |
36673078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #269
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 40277895 - 40277937
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||| ||||||| |
|
|
| T |
40277895 |
ttttggtccctgaaaatatgtctcgttttgattttggtccctg |
40277937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #270
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 122 - 156
Target Start/End: Original strand, 42446524 - 42446558
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatg |
156 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
42446524 |
taggctaaaatatgcttttggtccctgcaaatatg |
42446558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #271
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 45002094 - 45002136
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||| ||||||| |
|
|
| T |
45002094 |
ttttggtccctacaaatatgtctcattttggttttggtccctg |
45002136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #272
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 45005959 - 45006001
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||||| |
|
|
| T |
45005959 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
45006001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #273
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 171
Target Start/End: Complemental strand, 47114741 - 47114707
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggtttt |
171 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
47114741 |
tttttgtccctgcaaatatgtctcgttttggtttt |
47114707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #274
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 127 - 177
Target Start/End: Original strand, 47901803 - 47901853
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
177 |
Q |
| |
|
|||||||||||||| ||| ||| ||||||| ||||||||||||||||||| |
|
|
| T |
47901803 |
taaaatatggttttagtctctggaaatatgcatcgttttggttttagtccc |
47901853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #275
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 197 - 231
Target Start/End: Original strand, 52342208 - 52342242
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggtttt |
231 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
52342208 |
ttttggtccctgcaaatatgcctccttttggtttt |
52342242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #276
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 52342509 - 52342467
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||||| |
|
|
| T |
52342509 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
52342467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #277
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 52956627 - 52956585
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||||| |
|
|
| T |
52956627 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
52956585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #278
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 118 - 180
Target Start/End: Original strand, 53701355 - 53701417
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||| ||||||||||||||||| || ||||||||||| || |||| |||||||||||||| |
|
|
| T |
53701355 |
atttttggctaaaatatggttttaatctctgcaaatatgccttattttagttttagtccctgt |
53701417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #279
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 171
Target Start/End: Original strand, 54767244 - 54767278
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggtttt |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
54767244 |
ttttggtccctgcaaatatgtctcgttttgttttt |
54767278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #280
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 197 - 238
Target Start/End: Complemental strand, 3830503 - 3830462
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcctt |
238 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
3830503 |
ttttagtccctgcaaatatgcctcgttttggttttagtcctt |
3830462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #281
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 127 - 180
Target Start/End: Original strand, 10778373 - 10778426
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||| || ||||||||||| ||||||||| ||||||| ||||| |
|
|
| T |
10778373 |
taaaatatggttttagtttctgcaaatatgcctcgttttgattttagttcctgt |
10778426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #282
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 137 - 178
Target Start/End: Original strand, 14772285 - 14772326
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||||||| |||| |
|
|
| T |
14772285 |
ttttggtccatgcaaatatgtctcgttttagttttagcccct |
14772326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #283
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 129 - 178
Target Start/End: Original strand, 16056352 - 16056401
Alignment:
| Q |
129 |
aaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
|||||||| ||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
16056352 |
aaatatggaattggtccctgcaaatatctggcgttttggttttagtccct |
16056401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #284
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 126 - 175
Target Start/End: Original strand, 16679678 - 16679727
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
175 |
Q |
| |
|
||||||||||||||| |||| || ||||||| ||||||||||||||||| |
|
|
| T |
16679678 |
ctaaaatatggttttagtccttgaaaatatgcttcgttttggttttagtc |
16679727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #285
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 197 - 238
Target Start/End: Complemental strand, 25610117 - 25610076
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcctt |
238 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||| |||||| |
|
|
| T |
25610117 |
ttttggtccctgcaaatatgcctcgttttgattttagtcctt |
25610076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #286
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 123 - 156
Target Start/End: Complemental strand, 26800170 - 26800137
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatg |
156 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |
|
|
| T |
26800170 |
aggctaaaatatggttttagtccctgcaaatatg |
26800137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #287
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 137 - 178
Target Start/End: Complemental strand, 28452303 - 28452262
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
28452303 |
ttttagtccctgcaaatatgtctcattttggttttggtccct |
28452262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #288
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 137 - 178
Target Start/End: Complemental strand, 29490670 - 29490629
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||| |||||| |
|
|
| T |
29490670 |
ttttggtccttgcaaatatatctcgttttggttttggtccct |
29490629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #289
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 122 - 179
Target Start/End: Complemental strand, 34588219 - 34588162
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34588219 |
taggctaaaatatgacattgatccctgcaaatatgttcagttttggttttagtccctg |
34588162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #290
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 137 - 178
Target Start/End: Complemental strand, 40370515 - 40370474
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| |||||| |
|
|
| T |
40370515 |
ttttggtccctgcaaatatgcctcattttggttttggtccct |
40370474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #291
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 121 - 174
Target Start/End: Original strand, 45313497 - 45313550
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
174 |
Q |
| |
|
||||||||||||||| ||||||||| || ||||||| |||||||| ||||||| |
|
|
| T |
45313497 |
ttaggctaaaatatgattttggtccttgtaaatatgattcgttttgattttagt |
45313550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #292
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 197 - 238
Target Start/End: Complemental strand, 47005506 - 47005465
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcctt |
238 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||| |||||| |
|
|
| T |
47005506 |
ttttggtccctgcaaatattcctcgttttggttttagtcctt |
47005465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #293
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 122 - 155
Target Start/End: Complemental strand, 54437528 - 54437495
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatat |
155 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
54437528 |
taggctaaaatatgtttttggtccctgcaaatat |
54437495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #294
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 119 - 179
Target Start/End: Original strand, 4705676 - 4705736
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||| |||||||||||| ||||| |||||||||||||| | |||| |||||| ||||||| |
|
|
| T |
4705676 |
tttttggctaaaatatgcttttgatccctgcaaatatggcgagtttaggttttggtccctg |
4705736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #295
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 119 - 155
Target Start/End: Complemental strand, 20585708 - 20585672
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatat |
155 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
20585708 |
ttttaggctaaaatatgtttttgatccctgcaaatat |
20585672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #296
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 203 - 231
Target Start/End: Complemental strand, 20907438 - 20907410
Alignment:
| Q |
203 |
tccctgcaaatatgcctcattttggtttt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
20907438 |
tccctgcaaatatgcctcattttggtttt |
20907410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #297
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 120 - 156
Target Start/End: Complemental strand, 38505642 - 38505606
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatg |
156 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
38505642 |
tttaggctaaaatatgcttttgctccctgcaaatatg |
38505606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #298
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 123 - 155
Target Start/End: Complemental strand, 40477434 - 40477402
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatat |
155 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
40477434 |
aggctaaaatatgattttggtccctgcaaatat |
40477402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #299
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 127 - 175
Target Start/End: Original strand, 40723121 - 40723169
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
175 |
Q |
| |
|
|||||||||||||| |||| ||||||||| |||| ||||||||||||| |
|
|
| T |
40723121 |
taaaatatggttttagtccttgcaaatattcctcgatttggttttagtc |
40723169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #300
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 123 - 171
Target Start/End: Original strand, 44506581 - 44506629
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttt |
171 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| | ||||||||||| |
|
|
| T |
44506581 |
aggctaaaatatggttttagtccctgcaaatataacgagttttggtttt |
44506629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #301
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 123 - 155
Target Start/End: Complemental strand, 44507859 - 44507827
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatat |
155 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
44507859 |
aggctaaaatatgattttggtccctgcaaatat |
44507827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #302
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 127 - 179
Target Start/End: Original strand, 49670477 - 49670529
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||| |||| |||| |||||||||| || |||||||||||| |||||| |
|
|
| T |
49670477 |
taaaatatgattttagtccttgcaaatatggcttgttttggttttaatccctg |
49670529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 82; Significance: 8e-39; HSPs: 242)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 116 - 236
Target Start/End: Original strand, 4423887 - 4424007
Alignment:
| Q |
116 |
tgattttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatat |
215 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
4423887 |
tgatttaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaatat |
4423986 |
T |
 |
| Q |
216 |
gcctcattttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
4423987 |
gcctcattttggttttggtcc |
4424007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 119 - 236
Target Start/End: Original strand, 20131312 - 20131429
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| | |
|
|
| T |
20131312 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtc |
20131411 |
T |
 |
| Q |
219 |
tcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
20131412 |
tcattttggttttggtcc |
20131429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 122 - 236
Target Start/End: Original strand, 10671628 - 10671742
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctca |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| || ||||||||||||||||||||||||| ||| |
|
|
| T |
10671628 |
taggctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtccctgtaattttatttttttgtttttggtccctgcaaatatgcttca |
10671727 |
T |
 |
| Q |
222 |
ttttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
10671728 |
ttttggttttggtcc |
10671742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 124 - 238
Target Start/End: Original strand, 42695868 - 42695982
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcatt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| | || |||||||||||||||||||||||| |||||| |
|
|
| T |
42695868 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctataattcttttttgttgtttttggtccctgcaaatatgtctcatt |
42695967 |
T |
 |
| Q |
224 |
ttggttttggtcctt |
238 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
42695968 |
ttggttttggtcctt |
42695982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 124 - 236
Target Start/End: Original strand, 4794130 - 4794242
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcatt |
223 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
4794130 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctgcaacaaaaatttgttgtttttggtccctgcaaatatgcctcatt |
4794229 |
T |
 |
| Q |
224 |
ttggttttggtcc |
236 |
Q |
| |
|
||||||||||||| |
|
|
| T |
4794230 |
ttggttttggtcc |
4794242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 123 - 235
Target Start/End: Original strand, 18113088 - 18113200
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
18113088 |
aggctaaaatatggttttggtccctgcaaatatgcctagttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaatatgcctcat |
18113187 |
T |
 |
| Q |
223 |
tttggttttggtc |
235 |
Q |
| |
|
||||||||||||| |
|
|
| T |
18113188 |
tttggttttggtc |
18113200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 120 - 236
Target Start/End: Complemental strand, 25705453 - 25705337
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcct |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||| || |
|
|
| T |
25705453 |
tttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtct |
25705354 |
T |
 |
| Q |
220 |
cattttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
25705353 |
cattttggttttggtcc |
25705337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 124 - 235
Target Start/End: Original strand, 34317798 - 34317909
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcatt |
223 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
34317798 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgtaatttttttttgttgtttttggtccctgcaaatatgcctcatt |
34317897 |
T |
 |
| Q |
224 |
ttggttttggtc |
235 |
Q |
| |
|
|||||||||||| |
|
|
| T |
34317898 |
ttggttttggtc |
34317909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 122 - 236
Target Start/End: Original strand, 41451835 - 41451949
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctca |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||| |||||||||||||| |||| |
|
|
| T |
41451835 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttgttgtttttgatccctgcaaatatgtctca |
41451934 |
T |
 |
| Q |
222 |
ttttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
41451935 |
ttttggttttggtcc |
41451949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 123 - 236
Target Start/End: Original strand, 16673410 - 16673523
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||| || |||||||||||||||||||||||| ||||| |
|
|
| T |
16673410 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgcaagaaaattttgttgtttttggtccctgcaaatatgtctcat |
16673509 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
16673510 |
tttggttttggtcc |
16673523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 124 - 236
Target Start/End: Complemental strand, 5335040 - 5334928
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcatt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||| |||||| |
|
|
| T |
5335040 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaatatgtctcatt |
5334941 |
T |
 |
| Q |
224 |
ttggttttggtcc |
236 |
Q |
| |
|
||||||||||||| |
|
|
| T |
5334940 |
ttggttttggtcc |
5334928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 123 - 235
Target Start/End: Complemental strand, 36815836 - 36815724
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
36815836 |
aggctaaaatatggttttggtccatgcaaatatgtctcgttttggttttagttcctgtaatttttttttgttgtttttggtccctgcaaatatgcctcat |
36815737 |
T |
 |
| Q |
223 |
tttggttttggtc |
235 |
Q |
| |
|
|||| |||||||| |
|
|
| T |
36815736 |
tttgattttggtc |
36815724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 121 - 236
Target Start/End: Original strand, 146323 - 146438
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctc |
220 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||| ||| |
|
|
| T |
146323 |
ttagactaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaattttttgttgtttttggtccctgcaaatatgtctc |
146422 |
T |
 |
| Q |
221 |
attttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
146423 |
attttggttttggtcc |
146438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 121 - 236
Target Start/End: Original strand, 15842458 - 15842573
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctc |
220 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||| ||| |
|
|
| T |
15842458 |
ttaggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaatatgtctc |
15842557 |
T |
 |
| Q |
221 |
attttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
15842558 |
attttggttttggtcc |
15842573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 126 - 232
Target Start/End: Complemental strand, 44559407 - 44559301
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcatttt |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||| || |||||||||||||||||||||||| |||||||| |
|
|
| T |
44559407 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgtaaaattcttttgttgtttttggtccctgcaaatatgtctcatttt |
44559308 |
T |
 |
| Q |
226 |
ggttttg |
232 |
Q |
| |
|
||||||| |
|
|
| T |
44559307 |
ggttttg |
44559301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 123 - 236
Target Start/End: Original strand, 2481192 - 2481305
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| ||||| |
|
|
| T |
2481192 |
aggctaaaatatggttttggtacttgcaaatatgtctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaatatgtctcat |
2481291 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
2481292 |
tttggttttggtcc |
2481305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 119 - 236
Target Start/End: Original strand, 14003404 - 14003521
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| || |||||||||||||||||||||||| | |
|
|
| T |
14003404 |
ttttaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtc |
14003503 |
T |
 |
| Q |
219 |
tcattttggttttggtcc |
236 |
Q |
| |
|
||||||| |||||||||| |
|
|
| T |
14003504 |
tcattttagttttggtcc |
14003521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 123 - 236
Target Start/End: Complemental strand, 24358946 - 24358833
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||| ||||| |
|
|
| T |
24358946 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaatatgtctcat |
24358847 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
24358846 |
tttggttttggtcc |
24358833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 127 - 236
Target Start/End: Original strand, 29859490 - 29859599
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattttg |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||| ||||||||| |
|
|
| T |
29859490 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctcattttg |
29859589 |
T |
 |
| Q |
227 |
gttttggtcc |
236 |
Q |
| |
|
|||||||||| |
|
|
| T |
29859590 |
gttttggtcc |
29859599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 123 - 236
Target Start/End: Original strand, 30215421 - 30215534
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||| || |||||||||||||||||||||||| ||||| |
|
|
| T |
30215421 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctcat |
30215520 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
30215521 |
tttggttttggtcc |
30215534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 123 - 236
Target Start/End: Complemental strand, 37911121 - 37911008
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| ||||||| || ||||||||||||| |||||||||||||||| |
|
|
| T |
37911121 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttaatccctgtaaaatttttttgttgtttttggtccatgcaaatatgcctcat |
37911022 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
37911021 |
tttggttttggtcc |
37911008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 124 - 236
Target Start/End: Complemental strand, 4042890 - 4042778
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcatt |
223 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||| || || ||||||||||||||| ||||||||||||||| |
|
|
| T |
4042890 |
ggctaaaatatggtttaggtccctgcaaatatgtctcgttttggttttagtccttgcaaaaaaaaattgttgtttttggtccctacaaatatgcctcatt |
4042791 |
T |
 |
| Q |
224 |
ttggttttggtcc |
236 |
Q |
| |
|
||||||||||||| |
|
|
| T |
4042790 |
ttggttttggtcc |
4042778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 123 - 236
Target Start/End: Original strand, 16522990 - 16523101
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || |||||||||||||||||||||||||||| | |
|
|
| T |
16522990 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt--aattttttttttgtttttggtccctgcaaatatgcctcgt |
16523087 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|| ||||||||||| |
|
|
| T |
16523088 |
ttaggttttggtcc |
16523101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 124 - 236
Target Start/End: Original strand, 40124966 - 40125078
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcatt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||| ||||| || |||||||||||||||||||||||| |||||| |
|
|
| T |
40124966 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagttcctgtaatttttttttgttgtttttggtccctgcaaatatgtctcatt |
40125065 |
T |
 |
| Q |
224 |
ttggttttggtcc |
236 |
Q |
| |
|
||||||||||||| |
|
|
| T |
40125066 |
ttggttttggtcc |
40125078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 125 - 236
Target Start/End: Complemental strand, 20939324 - 20939213
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||| ||||| |||||| ||||||| |
|
|
| T |
20939324 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaattattttgttgtttttgggccctgtaaatatttctcattt |
20939225 |
T |
 |
| Q |
225 |
tggttttggtcc |
236 |
Q |
| |
|
|||||||||||| |
|
|
| T |
20939224 |
tggttttggtcc |
20939213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 123 - 236
Target Start/End: Complemental strand, 23732329 - 23732217
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |||||||||| |||||||||||| || |||||||||||||||||||||||| ||||| |
|
|
| T |
23732329 |
aggctaaaatatggttttggtctctgcaaatatgcctcgttttgg-tttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaatatgtctcat |
23732231 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
23732230 |
tttggttttggtcc |
23732217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 122 - 212
Target Start/End: Original strand, 13215058 - 13215148
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
13215058 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaattttttttgttgtttttggtccctgcaaa |
13215148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 122 - 236
Target Start/End: Complemental strand, 31909480 - 31909367
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctca |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||| || |||||||||||||||||||||||| || | |
|
|
| T |
31909480 |
taggctaaaatatggttttggtccctgcaaatatgcctc-ttttggttttagtctctgtaatttttttttgttgtttttggtccctgcaaatatgtctaa |
31909382 |
T |
 |
| Q |
222 |
ttttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
31909381 |
ttttggttttggtcc |
31909367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 123 - 212
Target Start/End: Original strand, 25705084 - 25705173
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
25705084 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
25705173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 122 - 180
Target Start/End: Original strand, 44559060 - 44559118
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44559060 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
44559118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 4424186 - 4424129
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4424186 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
4424129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 118 - 179
Target Start/End: Original strand, 24358610 - 24358671
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
24358610 |
attttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
24358671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 126 - 236
Target Start/End: Original strand, 1137983 - 1138094
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt-nnnnnnnnnttattgtttttggtccctgcaaatatgcctcattt |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| |||||||| || |||||||||||||||||||||||| ||| ||| |
|
|
| T |
1137983 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctgtaattttttttttgttgtttttggtccctgcaaatatgtctcgttt |
1138082 |
T |
 |
| Q |
225 |
tggttttggtcc |
236 |
Q |
| |
|
|||||||||||| |
|
|
| T |
1138083 |
tggttttggtcc |
1138094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 119 - 179
Target Start/End: Original strand, 33575747 - 33575807
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33575747 |
ttttaggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
33575807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 33576118 - 33576062
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33576118 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
33576062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 118 - 212
Target Start/End: Complemental strand, 2481563 - 2481469
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
2481563 |
atttaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
2481469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 122 - 180
Target Start/End: Complemental strand, 11788418 - 11788360
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11788418 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
11788360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 122 - 180
Target Start/End: Complemental strand, 16523327 - 16523269
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16523327 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
16523269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 123 - 212
Target Start/End: Complemental strand, 29859873 - 29859784
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
29859873 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaatttttgttgtttttggtccctgcaaa |
29859784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 130 - 235
Target Start/End: Original strand, 35155298 - 35155403
Alignment:
| Q |
130 |
aatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattttggtt |
229 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| || || ||||||||||||||||||||||||| || |||||||| |
|
|
| T |
35155298 |
aatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgcaaaaaaaaattgttgtttttggtccctgcaaatatgcttcgttttggtt |
35155397 |
T |
 |
| Q |
230 |
ttggtc |
235 |
Q |
| |
|
|||||| |
|
|
| T |
35155398 |
ttggtc |
35155403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 124 - 212
Target Start/End: Complemental strand, 146690 - 146602
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
146690 |
ggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
146602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 120 - 212
Target Start/End: Complemental strand, 1138363 - 1138271
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||| || |||||||||||||||||||| |
|
|
| T |
1138363 |
tttaggctaaaatatggttttgatccctgcaaatatgtctcgttttagttttagtccctgtaattttttgttgttgtttttggtccctgcaaa |
1138271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 17302144 - 17302087
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
17302144 |
aggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctgt |
17302087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 31644840 - 31644897
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31644840 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgt |
31644897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 124 - 180
Target Start/End: Original strand, 11713485 - 11713541
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11713485 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
11713541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 14003743 - 14003687
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
14003743 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
14003687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 15842824 - 15842768
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
15842824 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
15842768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 123 - 179
Target Start/End: Original strand, 19183781 - 19183837
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19183781 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
19183837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 124 - 180
Target Start/End: Original strand, 36622250 - 36622306
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36622250 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
36622306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 128 - 180
Target Start/End: Complemental strand, 36806892 - 36806840
Alignment:
| Q |
128 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36806892 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
36806840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 120 - 180
Target Start/End: Complemental strand, 44985988 - 44985928
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44985988 |
tttaggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgt |
44985928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 124 - 179
Target Start/End: Original strand, 5334751 - 5334806
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5334751 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
5334806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 124 - 179
Target Start/End: Complemental strand, 5790899 - 5790844
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5790899 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
5790844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 124 - 179
Target Start/End: Complemental strand, 20131681 - 20131626
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
20131681 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
20131626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 124 - 179
Target Start/End: Original strand, 26813866 - 26813921
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26813866 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
26813921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 122 - 176
Target Start/End: Complemental strand, 10671943 - 10671889
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
10671943 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
10671889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 121 - 179
Target Start/End: Complemental strand, 16673774 - 16673716
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
16673774 |
ttaggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccctg |
16673716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 122 - 180
Target Start/End: Complemental strand, 30215873 - 30215815
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
30215873 |
taggctaaaatatggttttggtccctgcaaatatatcgcgttttggttttagtccctgt |
30215815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 118 - 180
Target Start/End: Original strand, 33732856 - 33732918
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33732856 |
atttaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
33732918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 121 - 175
Target Start/End: Original strand, 38639409 - 38639463
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
175 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
38639409 |
ttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
38639463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 122 - 180
Target Start/End: Complemental strand, 40302341 - 40302283
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40302341 |
taggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctgt |
40302283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 118 - 180
Target Start/End: Original strand, 43597148 - 43597210
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43597148 |
attttaggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctgt |
43597210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 123 - 212
Target Start/End: Complemental strand, 43672319 - 43672230
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| | |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43672319 |
aggctaaaatatgattttggtccctgcaaatatgttttgttttggttttagtccctgtaaaaattttttattgtttttggtccctgcaaa |
43672230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 118 - 180
Target Start/End: Original strand, 44985615 - 44985677
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44985615 |
attttagactaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
44985677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 231
Target Start/End: Complemental strand, 16900207 - 16900101
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |||| ||||| ||||||||||||||||||| | |
|
|
| T |
16900207 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg--gtaaaaaaatattttttttagtccctgcaaatatgcctcgt |
16900110 |
T |
 |
| Q |
223 |
tttggtttt |
231 |
Q |
| |
|
||||||||| |
|
|
| T |
16900109 |
tttggtttt |
16900101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 231
Target Start/End: Complemental strand, 16993598 - 16993492
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |||| ||||| ||||||||||||||||||| | |
|
|
| T |
16993598 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg--gtaaaaaaatattttttttagtccctgcaaatatgcctcgt |
16993501 |
T |
 |
| Q |
223 |
tttggtttt |
231 |
Q |
| |
|
||||||||| |
|
|
| T |
16993500 |
tttggtttt |
16993492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 24483892 - 24483835
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24483892 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
24483835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 122 - 179
Target Start/End: Complemental strand, 26239162 - 26239105
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
26239162 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
26239105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 37228732 - 37228789
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
37228732 |
aggctaaaatatggttttggtccctgcaaatatgtatcgttttggttttagtctctgt |
37228789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 119 - 180
Target Start/End: Original strand, 40786455 - 40786516
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
40786455 |
ttttaggctaaaatatggttttattcactgcaaatatgtctcgttttggttttagtccctgt |
40786516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 41693673 - 41693730
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
41693673 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgt |
41693730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 124 - 180
Target Start/End: Original strand, 9195054 - 9195110
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9195054 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgt |
9195110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 124 - 180
Target Start/End: Complemental strand, 10375069 - 10375013
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
10375069 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaatccctgt |
10375013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 19184152 - 19184096
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
19184152 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
19184096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 26814230 - 26814174
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26814230 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
26814174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 124 - 180
Target Start/End: Complemental strand, 34964159 - 34964103
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
34964159 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttagttttagcccctgt |
34964103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 123 - 179
Target Start/End: Original strand, 37271738 - 37271794
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
37271738 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
37271794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 37272103 - 37272047
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
37272103 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
37272047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 38980254 - 38980198
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38980254 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
38980198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 121 - 180
Target Start/End: Original strand, 10664981 - 10665040
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
10664981 |
ttaggctaaaatatggttttagtccctgcaaatatgtctcgttttgatattagtccctgt |
10665040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 121 - 180
Target Start/End: Original strand, 43592043 - 43592102
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
43592043 |
ttaggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgt |
43592102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 117 - 175
Target Start/End: Complemental strand, 3832644 - 3832586
Alignment:
| Q |
117 |
gattttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
175 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3832644 |
gattataggttaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtc |
3832586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 122 - 180
Target Start/End: Complemental strand, 9195208 - 9195150
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9195208 |
taggctaaaatatggttttagaccctgcaaatatgcctcgttttggttttagtccctgt |
9195150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 121 - 171
Target Start/End: Complemental strand, 13215368 - 13215318
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttt |
171 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
13215368 |
ttaggctaaaatatgggtttggtccctgcaaatatgtctcgttttggtttt |
13215318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 118 - 176
Target Start/End: Complemental strand, 17541782 - 17541724
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
17541782 |
atttaaggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtcc |
17541724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 124 - 178
Target Start/End: Original strand, 27109073 - 27109127
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
27109073 |
ggctaaaatatggttttggtccctacaaatatgcctcgttttggttttagtccct |
27109127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 123 - 212
Target Start/End: Original strand, 32476094 - 32476183
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||| ||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
32476094 |
aggctaaaatatggttttgatccctgcaaatatgcctcattttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
32476183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 118 - 180
Target Start/End: Complemental strand, 41694009 - 41693947
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||| |||||||||||| |||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41694009 |
atttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt |
41693947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 122 - 176
Target Start/End: Original strand, 43788856 - 43788910
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
43788856 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
43788910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 2265398 - 2265341
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||| |||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2265398 |
aggctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagtccctgt |
2265341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 3837932 - 3837989
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3837932 |
aggctaaaatatagttttagtccctgcaaatatgtctcgttttcgttttagtccctgt |
3837989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 176
Target Start/End: Original strand, 4042609 - 4042662
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
4042609 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
4042662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 125 - 178
Target Start/End: Original strand, 4842865 - 4842918
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4842865 |
gctaaaatatggttttggatcctgcaaatatgtctcgttttggttttagtccct |
4842918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 119 - 180
Target Start/End: Complemental strand, 7814742 - 7814681
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
7814742 |
ttttaggctaaaatatgattttagtccctgcaaatatgcctcattttggttttagtccctgt |
7814681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 8046328 - 8046385
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8046328 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctgt |
8046385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 11713846 - 11713789
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11713846 |
aggctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
11713789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 118 - 175
Target Start/End: Original strand, 17912443 - 17912500
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
175 |
Q |
| |
|
|||||||| ||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
17912443 |
attttaggttaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtc |
17912500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 176
Target Start/End: Original strand, 22881612 - 22881665
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
22881612 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
22881665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 124 - 212
Target Start/End: Original strand, 23732039 - 23732127
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||||||||||||| ||| || |||||||||||||||||||| |
|
|
| T |
23732039 |
ggctaaaatatgattttgatccctgcaaatatgtctcgttttggttttagtccatgtaaaaaaattttgttgtttttggtccctgcaaa |
23732127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 127 - 180
Target Start/End: Original strand, 26238816 - 26238869
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
26238816 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt |
26238869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 234
Target Start/End: Original strand, 29831813 - 29831922
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||||||||||||||||| | ||| | | | |||||||||||||||||||||||||||| | |
|
|
| T |
29831813 |
aggctaaaatatagttttgatccctgcaaatatgtctcgttttggtttcaatccttataattttttgt--ttgtttttggtccctgcaaatatgcctcgt |
29831910 |
T |
 |
| Q |
223 |
tttggttttggt |
234 |
Q |
| |
|
|||||||||||| |
|
|
| T |
29831911 |
tttggttttggt |
29831922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 35155620 - 35155563
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |||||| ||||||||||||| |
|
|
| T |
35155620 |
aggctaaaatatggttttggtccctgaaaatatgtcttgttttgattttagtccctgt |
35155563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 38731828 - 38731885
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38731828 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
38731885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 127 - 180
Target Start/End: Original strand, 42358702 - 42358755
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42358702 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
42358755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 43597500 - 43597443
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||| |||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43597500 |
aggctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtccctgt |
43597443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 118 - 179
Target Start/End: Complemental strand, 44073813 - 44073752
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
44073813 |
atttaaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
44073752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 124 - 180
Target Start/End: Complemental strand, 3671192 - 3671136
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3671192 |
ggctcaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
3671136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 124 - 180
Target Start/End: Complemental strand, 8046648 - 8046592
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| |||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
8046648 |
ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgt |
8046592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 123 - 179
Target Start/End: Original strand, 17541381 - 17541437
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
17541381 |
aggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctg |
17541437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 119 - 175
Target Start/End: Original strand, 23989833 - 23989889
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
175 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
23989833 |
ttttaggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
23989889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 122 - 178
Target Start/End: Complemental strand, 27311071 - 27311015
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
27311071 |
taggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccct |
27311015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 121 - 180
Target Start/End: Original strand, 3671000 - 3671059
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||| ||||||||| ||||||||||||| |
|
|
| T |
3671000 |
ttaggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagtccctgt |
3671059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 125 - 180
Target Start/End: Complemental strand, 3838263 - 3838208
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3838263 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgt |
3838208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 129 - 180
Target Start/End: Complemental strand, 4794468 - 4794417
Alignment:
| Q |
129 |
aaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
4794468 |
aaatatggttttggtccctacaaatatgtctcgttttggttttagtctctgt |
4794417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 124 - 179
Target Start/End: Original strand, 5790558 - 5790613
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||| || ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5790558 |
ggctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtccctg |
5790613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 125 - 180
Target Start/End: Original strand, 10374775 - 10374830
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
10374775 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt |
10374830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 125 - 180
Target Start/End: Original strand, 29865222 - 29865277
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29865222 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt |
29865277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 122 - 212
Target Start/End: Original strand, 36815486 - 36815576
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
|||||||||||||||||||| | ||| ||||||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
36815486 |
taggctaaaatatggttttgccctctgtaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
36815576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #119
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 125 - 176
Target Start/End: Complemental strand, 42696202 - 42696151
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
42696202 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
42696151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #120
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 122 - 180
Target Start/End: Original strand, 13850520 - 13850578
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||| |||||| || |||||||||||||||| |||||||||||||||||| |
|
|
| T |
13850520 |
taggctaaaatatagttttgatctctgcaaatatgtctcgatttggttttagtccctgt |
13850578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #121
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 122 - 180
Target Start/End: Original strand, 20658059 - 20658117
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
20658059 |
taggctaaaacatggttttagtccctgcaaatatgccttgttttggttttagtccctgt |
20658117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #122
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 123 - 236
Target Start/End: Original strand, 29182167 - 29182280
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
||||||||||||| ||||||||| ||||||||||| || |||||||||||||| |||| || ||||||||||||| |||||||||| || | |
|
|
| T |
29182167 |
aggctaaaatatgattttggtccttgcaaatatgtttcattttggttttagtctctgtaatttctttttgttgtttttggtccatgcaaatatgtatcgt |
29182266 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
||||||||| |||| |
|
|
| T |
29182267 |
tttggttttcgtcc |
29182280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #123
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 122 - 180
Target Start/End: Complemental strand, 29865513 - 29865455
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
29865513 |
taggctaaaatatggttttagtccttgcaaatatgcttcgttttggttttagtccctgt |
29865455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #124
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 124 - 178
Target Start/End: Complemental strand, 33733241 - 33733187
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
33733241 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccct |
33733187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #125
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 123 - 212
Target Start/End: Complemental strand, 40125290 - 40125201
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||| |||||||||||||| || |||||||||||||||||||| |
|
|
| T |
40125290 |
aggctaaaatatgattttggtccctgcaaatatgcctcatttttgttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
40125201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #126
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 118 - 236
Target Start/End: Original strand, 43671928 - 43672044
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgc |
217 |
Q |
| |
|
|||| |||||||||||||||||| ||||||| ||||||| |||||||||||||||| ||||| || |||||||||||||||||||||||| |
|
|
| T |
43671928 |
atttaaggctaaaatatggtttttgtccctgtaaatatgcttcgttttggttttagttcctgt--aattttttttttgtttttggtccctgcaaatatgt |
43672025 |
T |
 |
| Q |
218 |
ctcattttggttttggtcc |
236 |
Q |
| |
|
|| |||||||||| |||| |
|
|
| T |
43672026 |
ttcgttttggttttcgtcc |
43672044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #127
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 127 - 180
Target Start/End: Complemental strand, 1295544 - 1295491
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||| | ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1295544 |
taaaatatggttttgattcctgcaaatatgtttcgttttggttttagtccctgt |
1295491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #128
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 119 - 180
Target Start/End: Original strand, 1497605 - 1497666
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||| ||||||||||||||||| |||| |||||||||| ||||||||| ||||||||||||| |
|
|
| T |
1497605 |
tttttggctaaaatatggttttagtccttgcaaatatgcctcgttttgattttagtccctgt |
1497666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #129
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 123 - 176
Target Start/End: Original strand, 3172019 - 3172072
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
3172019 |
aggctaaaatatgattttggtccctgcaaatatgcctcattttggttttagtcc |
3172072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #130
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 123 - 176
Target Start/End: Complemental strand, 3172533 - 3172480
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
3172533 |
aggctaaaatatgattttggtccttgcaaatatgcctcgttttggttttagtcc |
3172480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #131
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 123 - 176
Target Start/End: Original strand, 25954114 - 25954167
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
25954114 |
aggctaaaatatgtttttagtccctgcaaatatgtttcgttttggttttagtcc |
25954167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #132
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 27310875 - 27310931
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
27310875 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgg-tttagtccctgt |
27310931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #133
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 121 - 174
Target Start/End: Complemental strand, 29182445 - 29182392
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
174 |
Q |
| |
|
|||| |||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
29182445 |
ttagactaaaatatgattttgatccctgcaaatatgtctcgttttggttttagt |
29182392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #134
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 40301974 - 40302031
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| |||| |||||||||||||| |
|
|
| T |
40301974 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtccctgt |
40302031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #135
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 44994062 - 44994005
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
44994062 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttagttttagtctctgt |
44994005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #136
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 123 - 176
Target Start/End: Complemental strand, 45442697 - 45442644
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||||| |||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
45442697 |
aggctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagtcc |
45442644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #137
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 123 - 179
Target Start/End: Original strand, 7814245 - 7814301
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||| ||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
7814245 |
aggctaaaatattgttttagtccctgtaaatatgcctcgttttggttttagtccctg |
7814301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #138
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 124 - 180
Target Start/End: Original strand, 12835325 - 12835381
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
12835325 |
ggctaaaatatgattttagtccctgcaaatatgcctcattttggttttagtccctgt |
12835381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #139
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 124 - 180
Target Start/End: Complemental strand, 18113454 - 18113398
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||||||||||| ||||||| |
|
|
| T |
18113454 |
ggctaaaatatggttttggtccctacaaatatgcttcgttttggttttaatccctgt |
18113398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #140
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 127 - 175
Target Start/End: Complemental strand, 23990193 - 23990145
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
175 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
23990193 |
taaaatatggttttagtccttgcaaatatgtctcgttttggttttagtc |
23990145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #141
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 124 - 180
Target Start/End: Complemental strand, 31226077 - 31226021
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
31226077 |
ggctaaaatatggttttactccctgcaaatatgcctcgttttggttttactccctgt |
31226021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #142
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 124 - 176
Target Start/End: Complemental strand, 34318083 - 34318031
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||||||| ||||||||| |
|
|
| T |
34318083 |
ggctaaaatatggttttggtccctacaaatatgcctcgttttgattttagtcc |
34318031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #143
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 124 - 179
Target Start/End: Original strand, 38979889 - 38979945
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatat-gtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38979889 |
ggctaaaatatggttttagtccctgcaaatatattctcgttttggttttagtccctg |
38979945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #144
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 43789193 - 43789137
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||||||||||||| |
|
|
| T |
43789193 |
aggctaaaatatggttttagttcctgcaaatatgcttcgttttggttttagtccctg |
43789137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #145
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 127 - 174
Target Start/End: Original strand, 5006610 - 5006657
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
174 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
5006610 |
taaaatatggttttggtctctgcaaatatatctcgttttggttttagt |
5006657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #146
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 125 - 180
Target Start/End: Original strand, 24483401 - 24483456
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
24483401 |
gctaaaatatggctttagtccttgcaaatatgcctcgttttggttttagtccctgt |
24483456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #147
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 126 - 235
Target Start/End: Original strand, 25299747 - 25299857
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt-nnnnnnnnnttattgtttttggtccctgcaaatatgcctcattt |
224 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||||| ||||||||||||| || || |||||||||||||||||||||| ||||| |
|
|
| T |
25299747 |
ctaaaatatgattttggtccctgcaaatatgactcgttttaattttagtccctgtaaatttttttttgttatttttggtccctgcaaatatgctacattt |
25299846 |
T |
 |
| Q |
225 |
tggttttggtc |
235 |
Q |
| |
|
|| |||||||| |
|
|
| T |
25299847 |
tgattttggtc |
25299857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #148
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 127 - 174
Target Start/End: Complemental strand, 37229039 - 37228992
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
174 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
37229039 |
taaaatatggttttggtccctgcaaatatatttcgttttggttttagt |
37228992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #149
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 121 - 180
Target Start/End: Original strand, 37910753 - 37910812
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||| ||| |||| |||||||||||||| |
|
|
| T |
37910753 |
ttaggctaaaatatggttttgatccttgcaaatatgcctcattttagttttagtccctgt |
37910812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #150
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 118 - 232
Target Start/End: Original strand, 38231425 - 38231539
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgc |
217 |
Q |
| |
|
||||| |||||||||||| ||||| ||||||||||||| || |||||| ||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
38231425 |
atttttggctaaaatatgattttgatccctgcaaatataccttgttttgattttagtccctgtaatttttttgttttgtttttggtccctgcaaatatgt |
38231524 |
T |
 |
| Q |
218 |
ctcattttggttttg |
232 |
Q |
| |
|
||| ||||| ||||| |
|
|
| T |
38231525 |
ctcgttttgattttg |
38231539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #151
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 119 - 235
Target Start/End: Original strand, 11788047 - 11788164
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt-nnnnnnnnnttattgtttttggtccctgcaaatatgc |
217 |
Q |
| |
|
|||| |||||||||||| | ||| || ||||||| |||||||||||| |||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
11788047 |
tttttggctaaaatatgatgttgatctctgcaaaaatgtctcgttttcgttttagtccctgtaatatttttttttttgtttttggtcgctgcaaatatgt |
11788146 |
T |
 |
| Q |
218 |
ctcattttggttttggtc |
235 |
Q |
| |
|
||| |||||||||||||| |
|
|
| T |
11788147 |
ctcgttttggttttggtc |
11788164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #152
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 121 - 171
Target Start/End: Complemental strand, 20658412 - 20658362
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttt |
171 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
20658412 |
ttaggctaaaatatggttttaatccctgcaaatatgtctcgttttgatttt |
20658362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #153
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 142 - 180
Target Start/End: Complemental strand, 22881950 - 22881912
Alignment:
| Q |
142 |
gtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22881950 |
gtccctgcaaatatgtctcgttttggttttagtccctgt |
22881912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #154
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 122 - 180
Target Start/End: Original strand, 26707871 - 26707929
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26707871 |
taggctaaaatatggttttaatccctgcaaatatacttcgttttggttttagtccctgt |
26707929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #155
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 123 - 212
Target Start/End: Complemental strand, 31326253 - 31326164
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
|||||||||||| ||||| |||| |||||||||| |||||||| |||||||||||||| || |||||||||||||||||||| |
|
|
| T |
31326253 |
aggctaaaatatagttttagtccttgcaaatatgcctcgttttagttttagtccctgtaaaataaaatttttgtttttggtccctgcaaa |
31326164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #156
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 122 - 180
Target Start/End: Original strand, 32691311 - 32691369
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||| || ||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
32691311 |
taggctaaaatatggttttagtttctgcaaatatgcctcgttttggttttaatccctgt |
32691369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #157
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 126 - 180
Target Start/End: Original strand, 41791020 - 41791074
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||| ||||||| ||||||| ||| ||||||||||||||||||| |
|
|
| T |
41791020 |
ctaaaatatggttttagtccctgtaaatatgcctcattttggttttagtccctgt |
41791074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #158
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 118 - 180
Target Start/End: Complemental strand, 43710714 - 43710652
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||| ||||||||||||| |||| | || |||||||||| ||||||||||||||||||||||| |
|
|
| T |
43710714 |
atttaaggctaaaatatgattttagcccttgcaaatatgcctcgttttggttttagtccctgt |
43710652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #159
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 126 - 179
Target Start/End: Complemental strand, 1497943 - 1497890
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||| ||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
1497943 |
ctaaaatatggttttattccttgcaaatatgcctcgttttggttttagtccctg |
1497890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #160
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 127 - 180
Target Start/End: Complemental strand, 13850881 - 13850828
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||||||||||||| |||| |
|
|
| T |
13850881 |
taaaatatggttttggttcctgcaaatatgcttcgttttggttttagtctctgt |
13850828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #161
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 127 - 180
Target Start/End: Original strand, 16968555 - 16968608
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||| |||||| |||||||| || |||||||||||||||||||| |
|
|
| T |
16968555 |
taaaatatggttttagtccctacaaatatgccttgttttggttttagtccctgt |
16968608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #162
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 127 - 180
Target Start/End: Complemental strand, 25954423 - 25954370
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||||||||| |
|
|
| T |
25954423 |
taaaatatggttttagtccttgcaaatatgcctcgttttgattttagtccctgt |
25954370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #163
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 122 - 175
Target Start/End: Original strand, 26709694 - 26709747
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
175 |
Q |
| |
|
|||||||||||||| |||| || |||||||||||||||||||||||| |||||| |
|
|
| T |
26709694 |
taggctaaaatatgattttagttcctgcaaatatgtctcgttttggtcttagtc |
26709747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #164
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 31225714 - 31225771
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||| ||||||||| ||||||| ||||| |
|
|
| T |
31225714 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagttcctgt |
31225771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #165
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 119 - 180
Target Start/End: Original strand, 31325915 - 31325976
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||| ||||||||||||||| | ||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
31325915 |
tttttggctaaaatatggttctagtccctgcaaatatgcatcgttttagttttagtccctgt |
31325976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #166
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 119 - 180
Target Start/End: Complemental strand, 41791317 - 41791256
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||| |||||||||||| |||| |||| |
|
|
| T |
41791317 |
tttttggctaaaatatggttttagtccctgcaaatatgcttcgttttggtttaagtctctgt |
41791256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #167
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 123 - 172
Target Start/End: Original strand, 45442315 - 45442364
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
172 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||||||||| ||||| |
|
|
| T |
45442315 |
aggctaaaatatggttttagtctctgcaaatatgtctcgttttgatttta |
45442364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #168
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 137 - 177
Target Start/End: Original strand, 1138055 - 1138095
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccc |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1138055 |
ttttggtccctgcaaatatgtctcgttttggttttggtccc |
1138095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #169
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 127 - 175
Target Start/End: Complemental strand, 17912808 - 17912760
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
175 |
Q |
| |
|
|||||||||||||| || |||||||||||| |||||||||||||||||| |
|
|
| T |
17912808 |
taaaatatggttttagttcctgcaaatatgcctcgttttggttttagtc |
17912760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #170
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 126 - 174
Target Start/End: Complemental strand, 25300038 - 25299991
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
25300038 |
ctaaaatatggttttggtccctgcaaatatgtttc-ttttggttttagt |
25299991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #171
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 126 - 174
Target Start/End: Complemental strand, 36622582 - 36622534
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
174 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
36622582 |
ctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagt |
36622534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #172
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 197 - 236
Target Start/End: Original strand, 3172033 - 3172072
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3172033 |
ttttggtccctgcaaatatgcctcattttggttttagtcc |
3172072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #173
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 17301983 - 17302036
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
||||||||||||||||||||| |||| |||||| |||||||||||||||||||||| |
|
|
| T |
17301983 |
aggctaaaatatggttttggt-cctgaaaatat-tctcgttttggttttagtccct |
17302036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #174
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 127 - 178
Target Start/End: Original strand, 43710384 - 43710435
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
|||||||| |||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43710384 |
taaaatataattttagtcccttcaaatatgtctcgttttggttttagtccct |
43710435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #175
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 146399 - 146441
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
146399 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
146441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #176
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 2481266 - 2481308
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
2481266 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
2481308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #177
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 193 - 235
Target Start/End: Original strand, 3832340 - 3832382
Alignment:
| Q |
193 |
ttgtttttggtccctgcaaatatgcctcattttggttttggtc |
235 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
3832340 |
ttgtttttagtccctgcaaatatgtctcattttggttttggtc |
3832382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #178
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 5334967 - 5334925
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
5334967 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
5334925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #179
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 15842534 - 15842576
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
15842534 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
15842576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #180
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 16673484 - 16673526
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
16673484 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
16673526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #181
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 118 - 180
Target Start/End: Original strand, 19831502 - 19831564
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||| ||| |||||||||||||| ||| ||||||||||| |||||||||||||||| ||||| |
|
|
| T |
19831502 |
atttaaggttaaaatatggttttagtctttgcaaatatgtttcgttttggttttagttcctgt |
19831564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #182
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 20131390 - 20131432
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
20131390 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
20131432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #183
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 23732256 - 23732214
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
23732256 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
23732214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #184
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 24358872 - 24358830
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
24358872 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
24358830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #185
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 25705376 - 25705334
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
25705376 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
25705334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #186
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 29859560 - 29859602
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
29859560 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
29859602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #187
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 30215495 - 30215537
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
30215495 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
30215537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #188
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 123 - 165
Target Start/End: Complemental strand, 32691636 - 32691594
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgtttt |
165 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
32691636 |
aggctaaaacatggttttagtccctgcaaatatgtctcgtttt |
32691594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #189
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 37228795 - 37228837
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
37228795 |
ttttggtccctgcaaatgtgtctcgttttggttttggtccctg |
37228837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #190
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 40125039 - 40125081
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
40125039 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
40125081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #191
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 43672005 - 43672047
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
43672005 |
ttttggtccctgcaaatatgtttcgttttggttttcgtccctg |
43672047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #192
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 126 - 180
Target Start/End: Original strand, 44993806 - 44993859
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||| | |||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
44993806 |
ctaaaatatggttgtagtcc-tgcaaatatgtctcgttttggttttactccctgt |
44993859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #193
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 123 - 175
Target Start/End: Original strand, 1295181 - 1295234
Alignment:
| Q |
123 |
aggctaaa-atatggttttggtccctgcaaatatgtctcgttttggttttagtc |
175 |
Q |
| |
|
|||||||| ||||| ||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
1295181 |
aggctaaatatatgattttggtccatgtaaatatgtctcgttttggttttagtc |
1295234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #194
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 122 - 179
Target Start/End: Complemental strand, 2412489 - 2412432
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| | |||| |||||||||||||| |
|
|
| T |
2412489 |
taggctaaaatatgtttttggtccctgcaaatatagcgagtttgggttttagtccctg |
2412432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #195
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 10665295 - 10665238
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||| ||||| ||| ||||||||||| |||||||||||||||| ||||| |
|
|
| T |
10665295 |
aggctaaaatatagttttagtctctgcaaatatgcatcgttttggttttagttcctgt |
10665238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #196
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 123 - 176
Target Start/End: Complemental strand, 14393129 - 14393077
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||||| ||| | ||| |||||||||||||||||||||||||||||| |
|
|
| T |
14393129 |
aggctaaaatatgatttagttcc-tgcaaatatgtctcgttttggttttagtcc |
14393077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #197
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 118 - 155
Target Start/End: Original strand, 25977864 - 25977901
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatat |
155 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
25977864 |
attttaggctaaaatatgtttttggtccctgcaaatat |
25977901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #198
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 134 - 179
Target Start/End: Complemental strand, 33576076 - 33576031
Alignment:
| Q |
134 |
tggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
33576076 |
tggttttagtccctgcaaatatgtctcattttggttttggtccctg |
33576031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #199
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 122 - 235
Target Start/End: Complemental strand, 35686340 - 35686230
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctca |
221 |
Q |
| |
|
|||| ||||||||||||||| |||||| ||||||| |||||||||||||||| |||| || |||||||||||||||||||||||| | |
|
|
| T |
35686340 |
taggataaaatatggttttgatccctgtaaatatgcttcgttttggttttagtttctgt---aatttatttttgtttttggtccctgcaaatatgatgcg |
35686244 |
T |
 |
| Q |
222 |
ttttggttttggtc |
235 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
35686243 |
ttttggttttggtc |
35686230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #200
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 123 - 176
Target Start/End: Complemental strand, 43592381 - 43592328
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||||| |||| |||||||| |||||||||| ||||| ||||||||| |
|
|
| T |
43592381 |
aggctaaaatatgattttagtccctgctaatatgtctcattttgattttagtcc |
43592328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #201
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 5163952 - 5164005
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||||| || | ||||||||||||||||||||||||||| |
|
|
| T |
5163952 |
aggctaaaatatggttttggtctct----acatgtctcgttttggttttagtccctgt |
5164005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #202
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 121 - 235
Target Start/End: Complemental strand, 5164488 - 5164385
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctc |
220 |
Q |
| |
|
||||| ||||||||||||||| | ||||||||||||||| ||||| ||||| ||| || || ||||||||||||| |||||||||| ||| |
|
|
| T |
5164488 |
ttaggttaaaatatggttttgattcctgcaaatatgtcttgttttagttttggtctct-----------ttgttgtttttggtccatgcaaatatgtctc |
5164400 |
T |
 |
| Q |
221 |
attttggttttggtc |
235 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
5164399 |
gttttggttttggtc |
5164385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #203
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 118 - 154
Target Start/End: Original strand, 15531023 - 15531059
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaata |
154 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |
|
|
| T |
15531023 |
attttaggctaaaatatgtttttggtccctgcaaata |
15531059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #204
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 120 - 180
Target Start/End: Original strand, 34963791 - 34963851
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||| ||||||||||||||||| ||||||| ||||||| | |||||| |||||||| |||| |
|
|
| T |
34963791 |
tttatgctaaaatatggttttgatccctgctaatatgttttgttttgattttagtctctgt |
34963851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #205
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 127 - 170
Target Start/End: Complemental strand, 1696452 - 1696409
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttt |
170 |
Q |
| |
|
||||||||| |||| |||||| |||||||||||||||||||||| |
|
|
| T |
1696452 |
taaaatatgattttcgtcccttcaaatatgtctcgttttggttt |
1696409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #206
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 2481544 - 2481505
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
2481544 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
2481505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #207
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Original strand, 5334764 - 5334803
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
5334764 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
5334803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #208
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 193 - 236
Target Start/End: Original strand, 7121020 - 7121063
Alignment:
| Q |
193 |
ttgtttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
7121020 |
ttgtttttggtcattgcaaatatgtctcattttggttttggtcc |
7121063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #209
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 7814724 - 7814685
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
7814724 |
ttttagtccctgcaaatatgcctcattttggttttagtcc |
7814685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #210
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Original strand, 12835338 - 12835377
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
12835338 |
ttttagtccctgcaaatatgcctcattttggttttagtcc |
12835377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #211
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 14003729 - 14003690
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
14003729 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
14003690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #212
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 15842810 - 15842771
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
15842810 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
15842771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #213
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 16523312 - 16523273
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
16523312 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
16523273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #214
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 194 - 237
Target Start/End: Original strand, 19603748 - 19603791
Alignment:
| Q |
194 |
tgtttttggtccctgcaaatatgcctcattttggttttggtcct |
237 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
19603748 |
tgtttttggtccctgcaaatataactcatttgggttttggtcct |
19603791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #215
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 124 - 179
Target Start/End: Complemental strand, 19604978 - 19604923
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||| ||| ||| |||||| ||||||| |
|
|
| T |
19604978 |
ggctaaaatatgtttttggtccctgtaaatatggctcatttgggttttggtccctg |
19604923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #216
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 20131668 - 20131629
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
20131668 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
20131629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #217
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Original strand, 24358629 - 24358668
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
24358629 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
24358668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #218
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 29859859 - 29859820
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
29859859 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
29859820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #219
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Original strand, 32476108 - 32476147
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
32476108 |
ttttgatccctgcaaatatgcctcattttggttttagtcc |
32476147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #220
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 33576073 - 33576034
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
33576073 |
ttttagtccctgcaaatatgtctcattttggttttggtcc |
33576034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #221
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Original strand, 34317811 - 34317850
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
34317811 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
34317850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #222
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 121 - 180
Target Start/End: Complemental strand, 38732136 - 38732077
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||| |||||| || |||| ||||| ||||||||| ||||||||||||||| ||||||| |
|
|
| T |
38732136 |
ttaggttaaaatttgattttagtcccagcaaatatggctcgttttggttttaatccctgt |
38732077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #223
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 40125276 - 40125237
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
40125276 |
ttttggtccctgcaaatatgcctcatttttgttttagtcc |
40125237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #224
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 4423968 - 4424010
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||||| |
|
|
| T |
4423968 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
4424010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #225
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 4794203 - 4794245
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||||| |
|
|
| T |
4794203 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
4794245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #226
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 14003482 - 14003524
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||| ||||||| |
|
|
| T |
14003482 |
ttttggtccctgcaaatatgtctcattttagttttggtccctg |
14003524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #227
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 16523062 - 16523104
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||| ||||||| |
|
|
| T |
16523062 |
ttttggtccctgcaaatatgcctcgtttaggttttggtccctg |
16523104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #228
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 194 - 236
Target Start/End: Complemental strand, 19604968 - 19604926
Alignment:
| Q |
194 |
tgtttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||| ||||||| ||||||| ||||||||||| |
|
|
| T |
19604968 |
tgtttttggtccctgtaaatatggctcatttgggttttggtcc |
19604926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #229
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 122 - 156
Target Start/End: Original strand, 23861750 - 23861784
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatg |
156 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
23861750 |
taggctaaaatatgtttttggtccctgcaaatatg |
23861784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #230
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 29182241 - 29182283
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||| ||||||| |
|
|
| T |
29182241 |
ttttggtccatgcaaatatgtatcgttttggttttcgtccctg |
29182283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #231
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 31909406 - 31909364
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
31909406 |
ttttggtccctgcaaatatgtctaattttggttttggtccctg |
31909364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #232
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 41451910 - 41451952
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
41451910 |
ttttgatccctgcaaatatgtctcattttggttttggtccctg |
41451952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #233
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 129 - 174
Target Start/End: Original strand, 11943543 - 11943588
Alignment:
| Q |
129 |
aaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
174 |
Q |
| |
|
|||||||||||| ||| ||| |||||||||||||||||||||||| |
|
|
| T |
11943543 |
aaatatggttttagtcaatgcgaatatgtctcgttttggttttagt |
11943588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #234
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 198 - 235
Target Start/End: Complemental strand, 13215351 - 13215314
Alignment:
| Q |
198 |
tttggtccctgcaaatatgcctcattttggttttggtc |
235 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
13215351 |
tttggtccctgcaaatatgtctcgttttggttttggtc |
13215314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #235
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 197 - 238
Target Start/End: Original strand, 22881626 - 22881667
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcctt |
238 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
22881626 |
ttttagtccctgcaaatatgcctcgttttggttttagtcctt |
22881667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #236
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 124 - 180
Target Start/End: Original strand, 35685972 - 35686029
Alignment:
| Q |
124 |
ggctaaaatatggtttt-ggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||| |||| ||| |||||||||||| ||||||| |||||||||||||| |
|
|
| T |
35685972 |
ggctaaaatatgatttttggttcctgcaaatatggttcgttttagttttagtccctgt |
35686029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #237
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 197 - 238
Target Start/End: Original strand, 43788871 - 43788912
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcctt |
238 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
43788871 |
ttttagtccctgcaaatatgcctcgttttggttttagtcctt |
43788912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #238
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 123 - 155
Target Start/End: Original strand, 1777468 - 1777500
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatat |
155 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
1777468 |
aggctaaaatatgtttttggtccctgcaaatat |
1777500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #239
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 197 - 237
Target Start/End: Original strand, 4042623 - 4042663
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcct |
237 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| ||||| |
|
|
| T |
4042623 |
ttttgatccctgcaaatatgcctcgttttggttttagtcct |
4042663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #240
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 123 - 155
Target Start/End: Complemental strand, 25979311 - 25979279
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatat |
155 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
25979311 |
aggctaaaatatgtttttggtccctgcaaatat |
25979279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #241
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 144 - 180
Target Start/End: Complemental strand, 26708184 - 26708148
Alignment:
| Q |
144 |
ccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
26708184 |
ccctgcaaatacgcctcgttttggttttagtccctgt |
26708148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #242
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 196 - 236
Target Start/End: Original strand, 37228794 - 37228834
Alignment:
| Q |
196 |
tttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||| || ||| ||||||||||||||| |
|
|
| T |
37228794 |
tttttggtccctgcaaatgtgtctcgttttggttttggtcc |
37228834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 79; Significance: 5e-37; HSPs: 283)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 119 - 236
Target Start/End: Original strand, 10887228 - 10887345
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
10887228 |
ttttaggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgcc |
10887327 |
T |
 |
| Q |
219 |
tcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
10887328 |
tcattttggttttggtcc |
10887345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 120 - 236
Target Start/End: Original strand, 45380268 - 45380384
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcct |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| || |
|
|
| T |
45380268 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaatatgtct |
45380367 |
T |
 |
| Q |
220 |
cattttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
45380368 |
cattttggttttggtcc |
45380384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 123 - 236
Target Start/End: Complemental strand, 33000670 - 33000557
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| ||||| |
|
|
| T |
33000670 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaatatgtctcat |
33000571 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
33000570 |
tttggttttggtcc |
33000557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 122 - 236
Target Start/End: Original strand, 47819230 - 47819344
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctca |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
47819230 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaatatgtctca |
47819329 |
T |
 |
| Q |
222 |
ttttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
47819330 |
ttttggttttggtcc |
47819344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 119 - 236
Target Start/End: Complemental strand, 3247567 - 3247450
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcc |
218 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||| | |
|
|
| T |
3247567 |
ttttaggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaattttttgttgtttttggtccctgcaaatatgtc |
3247468 |
T |
 |
| Q |
219 |
tcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
3247467 |
tcattttggttttggtcc |
3247450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 127 - 236
Target Start/End: Original strand, 38150851 - 38150960
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattttg |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| ||||||||| |
|
|
| T |
38150851 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaaaatttttgttgtttttggtccctgcaaatatgtctcattttg |
38150950 |
T |
 |
| Q |
227 |
gttttggtcc |
236 |
Q |
| |
|
|||||||||| |
|
|
| T |
38150951 |
gttttggtcc |
38150960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 120 - 236
Target Start/End: Complemental strand, 30323297 - 30323181
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcct |
219 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||| || |
|
|
| T |
30323297 |
tttaggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtct |
30323198 |
T |
 |
| Q |
220 |
cattttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
30323197 |
cattttggttttggtcc |
30323181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 123 - 238
Target Start/End: Complemental strand, 44158043 - 44157928
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| || |||||||||||||||||| | || |||||||||||||||||||||||||||||| |
|
|
| T |
44158043 |
aggctaaaatatggtttttgtccctgcaaatatgcctagttttggttttagtccctataaaaaaaatttgttgtttttggtccctgcaaatatgcctcat |
44157944 |
T |
 |
| Q |
223 |
tttggttttggtcctt |
238 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
44157943 |
tttggttttggtcctt |
44157928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 122 - 236
Target Start/End: Complemental strand, 16026940 - 16026826
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctca |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
16026940 |
taggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgcaatttttttttgttgtttttggtccctgcaaatatgtctca |
16026841 |
T |
 |
| Q |
222 |
ttttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
16026840 |
ttttggttttggtcc |
16026826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 123 - 233
Target Start/End: Complemental strand, 24654168 - 24654058
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| || |||||||||||||||||||||||| ||||| |
|
|
| T |
24654168 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagcccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctcat |
24654069 |
T |
 |
| Q |
223 |
tttggttttgg |
233 |
Q |
| |
|
||||||||||| |
|
|
| T |
24654068 |
tttggttttgg |
24654058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 122 - 236
Target Start/End: Complemental strand, 35056896 - 35056782
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctca |
221 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
35056896 |
taggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctca |
35056797 |
T |
 |
| Q |
222 |
ttttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
35056796 |
ttttggttttggtcc |
35056782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 126 - 236
Target Start/End: Original strand, 46183686 - 46183796
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcatttt |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||| || || ||||||||||||||||||||||||||||||||| |
|
|
| T |
46183686 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccccgtaaaaaaaaattgttgtttttggtccctgcaaatatgcctcatttt |
46183785 |
T |
 |
| Q |
226 |
ggttttggtcc |
236 |
Q |
| |
|
||||||||||| |
|
|
| T |
46183786 |
ggttttggtcc |
46183796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 123 - 236
Target Start/End: Complemental strand, 10631529 - 10631416
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || |||||||||||| ||||||||||| ||||| |
|
|
| T |
10631529 |
aggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtctctgcaaatatgtctcat |
10631430 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
10631429 |
tttggttttggtcc |
10631416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 124 - 236
Target Start/End: Original strand, 24977778 - 24977891
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg-tnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| ||||| |
|
|
| T |
24977778 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaaaaaaatttgttgtttttggtccctgcaaatatgtctcat |
24977877 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
24977878 |
tttggttttggtcc |
24977891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 123 - 236
Target Start/End: Complemental strand, 31061152 - 31061039
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| || |||||||||||||||||||||||| ||||| |
|
|
| T |
31061152 |
aggctaaaatatggttttgatccctgcaaatatatctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaatatgtctcat |
31061053 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
31061052 |
tttggttttggtcc |
31061039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 127 - 236
Target Start/End: Original strand, 38163934 - 38164043
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattttg |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||| ||||||||| |
|
|
| T |
38163934 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctcattttg |
38164033 |
T |
 |
| Q |
227 |
gttttggtcc |
236 |
Q |
| |
|
|||||||||| |
|
|
| T |
38164034 |
gttttggtcc |
38164043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 124 - 236
Target Start/End: Original strand, 24507479 - 24507591
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcatt |
223 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||| |||||| |
|
|
| T |
24507479 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctcatt |
24507578 |
T |
 |
| Q |
224 |
ttggttttggtcc |
236 |
Q |
| |
|
||||||||||||| |
|
|
| T |
24507579 |
ttggttttggtcc |
24507591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 124 - 236
Target Start/End: Complemental strand, 38136981 - 38136869
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcatt |
223 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||| |||||| |
|
|
| T |
38136981 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctcatt |
38136882 |
T |
 |
| Q |
224 |
ttggttttggtcc |
236 |
Q |
| |
|
||||||||||||| |
|
|
| T |
38136881 |
ttggttttggtcc |
38136869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 124 - 236
Target Start/End: Original strand, 45638580 - 45638692
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcatt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||| || |||||||||||||||||||||||| |||||| |
|
|
| T |
45638580 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctcatt |
45638679 |
T |
 |
| Q |
224 |
ttggttttggtcc |
236 |
Q |
| |
|
||||||||||||| |
|
|
| T |
45638680 |
ttggttttggtcc |
45638692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 121 - 236
Target Start/End: Original strand, 4789305 - 4789420
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctc |
220 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||| ||||||||| ||| |
|
|
| T |
4789305 |
ttagactaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaattaatttttgttgtttttggtccccgcaaatatgtctc |
4789404 |
T |
 |
| Q |
221 |
attttggttttggtcc |
236 |
Q |
| |
|
||||| ||||||||| |
|
|
| T |
4789405 |
gttttgattttggtcc |
4789420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 125 - 238
Target Start/End: Original strand, 15058419 - 15058532
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| || ||||| | ||||||| |||||||||||||||| |
|
|
| T |
15058419 |
gctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccttgtaattttttattgttgttgtcggtccctacaaatatgcctcattt |
15058518 |
T |
 |
| Q |
225 |
tggttttggtcctt |
238 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
15058519 |
tggttttggtcctt |
15058532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 123 - 236
Target Start/End: Original strand, 16060595 - 16060707
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |||||||||||||||||| |||| || |||||||||||||||||||||||||||||| |
|
|
| T |
16060595 |
aggctaaaatatggttttggtccct-caaatatgcctcgttttggttttagtcactgtaaattttttttgttgtttttggtccctgcaaatatgcctcat |
16060693 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||| ||||||||| |
|
|
| T |
16060694 |
tttgattttggtcc |
16060707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 127 - 236
Target Start/End: Complemental strand, 19721071 - 19720962
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattttg |
226 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||| ||||||||| |
|
|
| T |
19721071 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaatatgtctcattttg |
19720972 |
T |
 |
| Q |
227 |
gttttggtcc |
236 |
Q |
| |
|
|||||||||| |
|
|
| T |
19720971 |
gttttggtcc |
19720962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 120 - 236
Target Start/End: Original strand, 33045351 - 33045468
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt-nnnnnnnnnttattgtttttggtccctgcaaatatgcc |
218 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| || |||||||||||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
33045351 |
tttaggctaaaatttggttttggtccctgcaaatatgcctagttttggttttagtccctgtaaaaaaatttttgttgtttttggtccctgcaaatatgca |
33045450 |
T |
 |
| Q |
219 |
tcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
33045451 |
tcattttggttttggtcc |
33045468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 123 - 236
Target Start/End: Original strand, 39747473 - 39747585
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |||||||||||||||||||||||| || ||||||||||||||||||||||||||| || |
|
|
| T |
39747473 |
aggctaaaatatggttttggtcc-tgcaaatacgtctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgccttat |
39747571 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
39747572 |
tttggttttggtcc |
39747585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 121 - 212
Target Start/End: Original strand, 8140431 - 8140522
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
8140431 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
8140522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 123 - 236
Target Start/End: Complemental strand, 8140800 - 8140686
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgc-aaatatgcctca |
221 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| || ||||||||||||||||| ||||||| |||| |
|
|
| T |
8140800 |
aggctaaaatatggttttggtacctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatatgtctca |
8140701 |
T |
 |
| Q |
222 |
ttttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
8140700 |
ttttggttttggtcc |
8140686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 126 - 236
Target Start/End: Complemental strand, 17130081 - 17129972
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcatttt |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |||||||||||||||| |||||||||| ||| |||| |
|
|
| T |
17130081 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaat-cctgtaattattttttattgtttttggtccttgcaaatatgtctcgtttt |
17129983 |
T |
 |
| Q |
226 |
ggttttggtcc |
236 |
Q |
| |
|
||||||||||| |
|
|
| T |
17129982 |
ggttttggtcc |
17129972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 123 - 212
Target Start/End: Original strand, 3247197 - 3247286
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
3247197 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
3247286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 123 - 212
Target Start/End: Complemental strand, 12360969 - 12360880
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
12360969 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaattttttttgttgtttttggtccctgcaaa |
12360880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 123 - 212
Target Start/End: Original strand, 19720711 - 19720800
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
19720711 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
19720800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 118 - 180
Target Start/End: Original strand, 21391090 - 21391152
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21391090 |
attttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
21391152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 122 - 180
Target Start/End: Complemental strand, 39747837 - 39747779
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39747837 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
39747779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 127 - 235
Target Start/End: Complemental strand, 7350733 - 7350625
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattttg |
226 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||||||||||||| ||| || |||||||||||||||||||||||||||| ||||| |
|
|
| T |
7350733 |
taaaatatggttttggtcactgcaaatatacctcgttttggttttagtccttgtaatatttttttgttgtttttggtccctgcaaatatgcctcgttttg |
7350634 |
T |
 |
| Q |
227 |
gttttggtc |
235 |
Q |
| |
|
||||||||| |
|
|
| T |
7350633 |
gttttggtc |
7350625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 121 - 178
Target Start/End: Complemental strand, 10887601 - 10887544
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10887601 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
10887544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 116 - 236
Target Start/End: Original strand, 15516574 - 15516694
Alignment:
| Q |
116 |
tgattttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatat |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| || ||||||||| |||| | |||||| |
|
|
| T |
15516574 |
tgattttaggctaaaatatggttttggtccctgcaaatatgccttgttttggttttagtccctgcaaaaaaaatttgttgtttttgatcccagaaaatat |
15516673 |
T |
 |
| Q |
216 |
gcctcattttggttttggtcc |
236 |
Q |
| |
|
| |||||||| |||||||||| |
|
|
| T |
15516674 |
gtctcattttagttttggtcc |
15516694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 124 - 236
Target Start/End: Complemental strand, 40718474 - 40718362
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcatt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | |||||| |||||||||||| || |||||||||||||||||||||||| |||||| |
|
|
| T |
40718474 |
ggctaaaatatggttttggtccctgcaaatatgcatagttttgattttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctcatt |
40718375 |
T |
 |
| Q |
224 |
ttggttttggtcc |
236 |
Q |
| |
|
||||||||||||| |
|
|
| T |
40718374 |
ttggttttggtcc |
40718362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 124 - 180
Target Start/End: Original strand, 10631164 - 10631220
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10631164 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
10631220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 15526363 - 15526307
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15526363 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
15526307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 123 - 179
Target Start/End: Original strand, 30322928 - 30322984
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30322928 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
30322984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 119 - 178
Target Start/End: Original strand, 19622650 - 19622709
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19622650 |
ttttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
19622709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 124 - 179
Target Start/End: Original strand, 35056530 - 35056585
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35056530 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35056585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 124 - 179
Target Start/End: Original strand, 40718110 - 40718165
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40718110 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
40718165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 121 - 179
Target Start/End: Complemental strand, 13260324 - 13260266
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13260324 |
ttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
13260266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 123 - 212
Target Start/End: Complemental strand, 24507844 - 24507755
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
24507844 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaattttgttgtttttggtccctgcaaa |
24507755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 119 - 212
Target Start/End: Complemental strand, 38151217 - 38151124
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
38151217 |
tttttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
38151124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 6567497 - 6567440
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6567497 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
6567440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 14007488 - 14007545
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14007488 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
14007545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 125 - 233
Target Start/End: Original strand, 32420099 - 32420206
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattt |
224 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||| || ||||||||||||| | |||||||||||| ||| |
|
|
| T |
32420099 |
gctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctg-caattttttttgttgtttttggtccttacaaatatgcctcgttt |
32420197 |
T |
 |
| Q |
225 |
tggttttgg |
233 |
Q |
| |
|
||||||||| |
|
|
| T |
32420198 |
tggttttgg |
32420206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 33045691 - 33045634
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33045691 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
33045634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 124 - 180
Target Start/End: Complemental strand, 12322970 - 12322914
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
12322970 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaatccctgt |
12322914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 119 - 179
Target Start/End: Original strand, 24653797 - 24653857
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
24653797 |
tttttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
24653857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 38164296 - 38164240
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38164296 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
38164240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 123 - 179
Target Start/End: Original strand, 45290456 - 45290512
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45290456 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
45290512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 47819597 - 47819541
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
47819597 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
47819541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 122 - 236
Target Start/End: Original strand, 12360601 - 12360715
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctca |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| |||| ||||||| |||||| || ||||||||| |||||||||||||| | | |
|
|
| T |
12360601 |
taggctaaaatatggttttggtccctgcaaatatgcctcattttagttttagcccctgtaattattttttgttgtttttgatccctgcaaatatgtcccg |
12360700 |
T |
 |
| Q |
222 |
ttttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
12360701 |
ttttggttttggtcc |
12360715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 122 - 236
Target Start/End: Complemental strand, 26324949 - 26324835
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctca |
221 |
Q |
| |
|
|||||||||||||| |||| |||| |||||||||| |||||||||||||||||| |||| || |||||||||||||||||||||||| ||| |
|
|
| T |
26324949 |
taggctaaaatatgattttagtccatgcaaatatgcctcgttttggttttagtctctgtaatttttttttgttgtttttggtccctgcaaatatgtctcg |
26324850 |
T |
 |
| Q |
222 |
ttttggttttggtcc |
236 |
Q |
| |
|
|||||||||| |||| |
|
|
| T |
26324849 |
ttttggttttcgtcc |
26324835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 124 - 179
Target Start/End: Original strand, 31060787 - 31060842
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
31060787 |
ggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctg |
31060842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 118 - 212
Target Start/End: Original strand, 33000299 - 33000393
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||| || |||||||||||||||||||| |
|
|
| T |
33000299 |
attttcggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
33000393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 123 - 236
Target Start/End: Original strand, 33234545 - 33234659
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnntt-attgtttttggtccctgcaaatatgcctca |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| || ||||||||| |||||||||||||| ||| |
|
|
| T |
33234545 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgtaatatttttttgtttgtttttgatccctgcaaatatgtctcg |
33234644 |
T |
 |
| Q |
222 |
ttttggttttggtcc |
236 |
Q |
| |
|
||||| ||||||||| |
|
|
| T |
33234645 |
ttttgattttggtcc |
33234659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 125 - 180
Target Start/End: Original strand, 44157696 - 44157751
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44157696 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
44157751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 121 - 172
Target Start/End: Complemental strand, 45638897 - 45638846
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45638897 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
45638846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 121 - 180
Target Start/End: Complemental strand, 48609597 - 48609538
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48609597 |
ttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcactgt |
48609538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 121 - 179
Target Start/End: Complemental strand, 990382 - 990324
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
990382 |
ttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
990324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 122 - 180
Target Start/End: Complemental strand, 11822367 - 11822309
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
11822367 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtccctgt |
11822309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 122 - 180
Target Start/End: Original strand, 13770487 - 13770545
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
13770487 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
13770545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 123 - 212
Target Start/End: Original strand, 15211510 - 15211599
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||| |||| || |||||||||||||||||||| |
|
|
| T |
15211510 |
aggctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtctctgtaaatttttgttgttgtttttggtccctgcaaa |
15211599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 122 - 180
Target Start/End: Original strand, 22919682 - 22919740
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22919682 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
22919740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 118 - 180
Target Start/End: Original strand, 25658008 - 25658070
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
25658008 |
atttttggctaaaatatggttttggtccccgcaaatatgtctcgttttggttttaatccctgt |
25658070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 126 - 180
Target Start/End: Original strand, 26207280 - 26207334
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
26207280 |
ctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctgt |
26207334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 122 - 180
Target Start/End: Original strand, 26324583 - 26324641
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26324583 |
taggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgt |
26324641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 122 - 180
Target Start/End: Original strand, 42482977 - 42483035
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
42482977 |
taggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtctctgt |
42483035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 1810926 - 1810983
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1810926 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
1810983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 119 - 180
Target Start/End: Original strand, 7867124 - 7867185
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
7867124 |
ttttaggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccctgt |
7867185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 7867358 - 7867301
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7867358 |
aggctaaaatatggttttggtccctgcaaatatgtcttattttggttttagtccctgt |
7867301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 18302388 - 18302331
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18302388 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
18302331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 122 - 179
Target Start/End: Original strand, 18473270 - 18473327
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
18473270 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
18473327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 29072496 - 29072553
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29072496 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
29072553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 32626528 - 32626585
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32626528 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgt |
32626585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 34002941 - 34002884
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
34002941 |
aggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccctgt |
34002884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 119 - 176
Target Start/End: Complemental strand, 35005749 - 35005692
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35005749 |
ttttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
35005692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 122 - 179
Target Start/End: Complemental strand, 41358665 - 41358608
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41358665 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
41358608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 118 - 179
Target Start/End: Complemental strand, 45290826 - 45290765
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
45290826 |
attttaggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctg |
45290765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 45368489 - 45368546
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45368489 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
45368546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 48609235 - 48609292
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
48609235 |
aggctaaaatatggttttagtcccggcaaatatgtctcgttttggttttagtccctgt |
48609292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 119 - 179
Target Start/End: Complemental strand, 7001902 - 7001842
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7001902 |
tttttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
7001842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 124 - 180
Target Start/End: Complemental strand, 16060885 - 16060829
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
16060885 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgt |
16060829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 124 - 180
Target Start/End: Original strand, 20948755 - 20948811
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
20948755 |
ggctaaaatatggttttggtccctacaaatatgtctcgtttgggttttagtccctgt |
20948811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 123 - 179
Target Start/End: Original strand, 26061955 - 26062011
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26061955 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
26062011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 124 - 176
Target Start/End: Complemental strand, 26191734 - 26191682
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
26191734 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
26191682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 124 - 176
Target Start/End: Original strand, 26442563 - 26442615
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
26442563 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
26442615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 32729050 - 32728994
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32729050 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
32728994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 124 - 180
Target Start/End: Complemental strand, 35308111 - 35308055
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35308111 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
35308055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 120 - 180
Target Start/End: Original strand, 39303670 - 39303730
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||| |||||||||||||||| |||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
39303670 |
tttatgctaaaatatggttttagtccctgcaagtatgtctcgttttggttttagtccctgt |
39303730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 123 - 179
Target Start/End: Original strand, 41358368 - 41358424
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
41358368 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
41358424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 124 - 235
Target Start/End: Original strand, 41738796 - 41738907
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcatt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||| |||||||||||||| || |||||||||||| || ||||||| ||| || |
|
|
| T |
41738796 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttagttttagtccctgtaaaaaaaaattgttgtttttggtctctacaaatatatctcgtt |
41738895 |
T |
 |
| Q |
224 |
ttggttttggtc |
235 |
Q |
| |
|
|||||||||||| |
|
|
| T |
41738896 |
ttggttttggtc |
41738907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 123 - 179
Target Start/End: Original strand, 41881092 - 41881148
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41881092 |
aggctaaaatatggttttagtccctccaaatatgtctcgttttggttttagtccctg |
41881148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 119 - 179
Target Start/End: Complemental strand, 46868582 - 46868522
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46868582 |
tttttggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctg |
46868522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 120 - 180
Target Start/End: Complemental strand, 50429213 - 50429153
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
50429213 |
tttaggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt |
50429153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 125 - 180
Target Start/End: Original strand, 3753214 - 3753269
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3753214 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
3753269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 120 - 179
Target Start/End: Complemental strand, 8364920 - 8364861
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
8364920 |
tttaggctaaaatatagttttggtccccgcaaatatgtctcgttttggttttcgtccctg |
8364861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 18473596 - 18473541
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
18473596 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
18473541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 125 - 180
Target Start/End: Original strand, 27521577 - 27521632
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
27521577 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt |
27521632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 122 - 212
Target Start/End: Complemental strand, 28507460 - 28507370
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |||| |||||||||||||| || |||||||||||||||||||| |
|
|
| T |
28507460 |
taggctaaaatattgttttggtccctgcaaatatgtctcattttagttttagtccctgtaattttttatttttgtttttggtccctgcaaa |
28507370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 121 - 180
Target Start/End: Complemental strand, 32454297 - 32454238
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
32454297 |
ttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggctttagtccctgt |
32454238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 33379887 - 33379942
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
33379887 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
33379942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 124 - 179
Target Start/End: Complemental strand, 45380636 - 45380581
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
45380636 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
45380581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 49073690 - 49073745
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
49073690 |
aggctaaaatatggttttggtccttgcaaatatgtctcgttttggttttaatccct |
49073745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 118 - 236
Target Start/End: Complemental strand, 49074059 - 49073941
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttt-agtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||| || ||||||| |||||||| |||| |||| |||| || ||||||||||||| |||||||||| |
|
|
| T |
49074059 |
attttaggctaaaatatggttttggtccttgtaaatatgcttcgttttgatttttagtctctgtaatttttt-ttgttgtttttggtccttgcaaatatg |
49073961 |
T |
 |
| Q |
217 |
cctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
49073960 |
cctcattttggttttggtcc |
49073941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 122 - 180
Target Start/End: Complemental strand, 4565338 - 4565280
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4565338 |
taggctaaaatatggttctggtccctgcaaatatgtctcgttttaattttagtccctgt |
4565280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 122 - 180
Target Start/End: Original strand, 13259986 - 13260044
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
13259986 |
taggctaaaatatggttttagtcgctgcaaatatggctcgttttggttttagtccctgt |
13260044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 123 - 235
Target Start/End: Original strand, 18079397 - 18079510
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt-nnnnnnnnnttattgtttttggtccctgcaaatatgcctca |
221 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||| ||| ||||||||||||||||||| || | |||||||||||||| ||||||||||| |
|
|
| T |
18079397 |
aggctaaaatacggttttggtccttgcaaatatgcctcattttggttttagtccctgtaattttttttttgtagtttttggtccctgtaaatatgcctcg |
18079496 |
T |
 |
| Q |
222 |
ttttggttttggtc |
235 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
18079497 |
ttttggttttggtc |
18079510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 122 - 180
Target Start/End: Original strand, 21383102 - 21383160
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||| |||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
21383102 |
taggctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtccctgt |
21383160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 126 - 236
Target Start/End: Complemental strand, 25658299 - 25658190
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcatttt |
225 |
Q |
| |
|
||||||||| ||||| |||||||||||||| ||||||||| ||||||||||||| || ||||| |||||||||||||||||||||||||| |
|
|
| T |
25658299 |
ctaaaatattcttttgatccctgcaaatatgcctcgttttgattttagtccctgtaaaaaaaa-ttgttgttaatggtccctgcaaatatgcctcatttt |
25658201 |
T |
 |
| Q |
226 |
ggttttggtcc |
236 |
Q |
| |
|
||||||||||| |
|
|
| T |
25658200 |
ggttttggtcc |
25658190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 122 - 180
Target Start/End: Original strand, 34808195 - 34808253
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||| |||||||||||||| |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
34808195 |
taggttaaaatatggttttagtcccttcaaatatgtctcgttttggttttagtccctgt |
34808253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 122 - 180
Target Start/End: Original strand, 50799128 - 50799186
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
50799128 |
taggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgt |
50799186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 118 - 180
Target Start/End: Complemental strand, 52254485 - 52254423
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
52254485 |
atttttggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgt |
52254423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 3679625 - 3679682
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
3679625 |
aggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgt |
3679682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 3753573 - 3753516
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
3753573 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctgt |
3753516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 176
Target Start/End: Original strand, 11822003 - 11822056
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
11822003 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
11822056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 12361010 - 12361067
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| |||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
12361010 |
aggctaaaatatggttttagtccctgcaaatttgcctcgttttggttttagtccctgt |
12361067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 127 - 180
Target Start/End: Original strand, 18899842 - 18899895
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
18899842 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgt |
18899895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 127 - 180
Target Start/End: Complemental strand, 18900130 - 18900077
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18900130 |
taaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctgt |
18900077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 122 - 175
Target Start/End: Original strand, 22674201 - 22674254
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
175 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
22674201 |
taggctaaaatatggtttaggtccatgcaaatatgtctcgttttggttttagtc |
22674254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 124 - 173
Target Start/End: Complemental strand, 22953556 - 22953507
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttag |
173 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
22953556 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttag |
22953507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 26442900 - 26442843
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
26442900 |
aggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccctgt |
26442843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 119 - 180
Target Start/End: Complemental strand, 29072867 - 29072806
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
29072867 |
tttttggctaaaatatggttttagtccctgcaaatatgcctcgctttggttttagtccctgt |
29072806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 35307714 - 35307771
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
35307714 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt |
35307771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 125 - 178
Target Start/End: Original strand, 44641079 - 44641132
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
44641079 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
44641132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 123 - 179
Target Start/End: Original strand, 990087 - 990143
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
990087 |
aggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctg |
990143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 125 - 212
Target Start/End: Complemental strand, 18928141 - 18928054
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||| ||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
18928141 |
gctaaaatatggttttggtcgctgcaaatatgtctcattttagttttagtcccggtaacatttttttattgtttttggtccctgcaaa |
18928054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 19623018 - 19622962
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
19623018 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
19622962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 120 - 180
Target Start/End: Complemental strand, 24649664 - 24649604
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||| ||||||||||||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
24649664 |
tttaggccaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgt |
24649604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 123 - 179
Target Start/End: Original strand, 31258338 - 31258394
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
31258338 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
31258394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 119 - 179
Target Start/End: Complemental strand, 31404727 - 31404667
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |||||||||| | ||||||||||||| |
|
|
| T |
31404727 |
ttttaggctaaaatatggttttggtccctacaaacatgtctcgttgttgttttagtccctg |
31404667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 120 - 176
Target Start/End: Original strand, 33067344 - 33067400
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||||||||||||||||| |||| |
|
|
| T |
33067344 |
tttaggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttggtcc |
33067400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 124 - 180
Target Start/End: Complemental strand, 33234912 - 33234856
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
33234912 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttgattttagtccctgt |
33234856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 123 - 179
Target Start/End: Original strand, 35005443 - 35005499
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
35005443 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
35005499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 122 - 166
Target Start/End: Original strand, 36912851 - 36912895
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttg |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36912851 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttg |
36912895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 124 - 180
Target Start/End: Complemental strand, 44641432 - 44641376
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44641432 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt |
44641376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 124 - 180
Target Start/End: Complemental strand, 48956066 - 48956010
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
48956066 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgt |
48956010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 123 - 174
Target Start/End: Complemental strand, 15058767 - 15058716
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
174 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
15058767 |
aggctaaaatattgttttgatccctgcaaatatgtctcgttttggttttagt |
15058716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 125 - 235
Target Start/End: Complemental strand, 19198948 - 19198838
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattt |
224 |
Q |
| |
|
||||||||||||||||| || ||||||||||| ||| ||||| ||||||||||||| | ||||||||||| ||||||||||||| || ||| |
|
|
| T |
19198948 |
gctaaaatatggttttgatctctgcaaatatgcctcattttgcttttagtccctgtaatatttttgttttgtttttggttcctgcaaatatgcttcgttt |
19198849 |
T |
 |
| Q |
225 |
tggttttggtc |
235 |
Q |
| |
|
||||||||||| |
|
|
| T |
19198848 |
tggttttggtc |
19198838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 124 - 179
Target Start/End: Original strand, 24649350 - 24649405
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
24649350 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagcccctg |
24649405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #145
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 29688429 - 29688374
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
29688429 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccct |
29688374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #146
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 116 - 179
Target Start/End: Complemental strand, 31258710 - 31258647
Alignment:
| Q |
116 |
tgattttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
31258710 |
tgattttagcttaaaatatggttttagtccctgcaaatatgcctcgtttttgttttagtccctg |
31258647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #147
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 124 - 179
Target Start/End: Original strand, 37545628 - 37545683
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
37545628 |
ggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccctg |
37545683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #148
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 127 - 212
Target Start/End: Original strand, 8364619 - 8364704
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||||||||||||| |||| || |||||||||||||||||||| |
|
|
| T |
8364619 |
taaaatatggttttgatccctgcaaatatgtttcgttttggttttagtcactgtaatttttttttgttgtttttggtccctgcaaa |
8364704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #149
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 126 - 180
Target Start/End: Original strand, 17129691 - 17129745
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||| | |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17129691 |
ctaaaatatggttttgattcctgcaaatatgcctcgttttggttttagtccctgt |
17129745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #150
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 124 - 178
Target Start/End: Complemental strand, 39025381 - 39025328
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
39025381 |
ggctaaaatatggttttggtccctgcaaa-atgcctcgttttggttttagtccct |
39025328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #151
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 4360627 - 4360570
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
4360627 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttggggttttagcccctgt |
4360570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #152
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 127 - 180
Target Start/End: Complemental strand, 5058989 - 5058936
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||||||||| ||||||||||||| |
|
|
| T |
5058989 |
taaaatatggttttggtccctggaaatatgcctcgttttgattttagtccctgt |
5058936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #153
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 127 - 176
Target Start/End: Original strand, 7350426 - 7350475
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7350426 |
taaaatatggttttagtccctgcaaatatgtctcattttggttttagtcc |
7350475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #154
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 124 - 235
Target Start/End: Original strand, 12322604 - 12322716
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt-nnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||| ||||||||| ||| || |||||||| ||| ||||||||||||||| | |
|
|
| T |
12322604 |
ggctaaaatatggttttgatccctgcaaatatgtttcgttttgattttagtccttgtaatttttttgtttttgttttttgtctctgcaaatatgcctcgt |
12322703 |
T |
 |
| Q |
223 |
tttggttttggtc |
235 |
Q |
| |
|
|||| |||||||| |
|
|
| T |
12322704 |
tttgattttggtc |
12322716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #155
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 124 - 232
Target Start/End: Original strand, 15466132 - 15466240
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcatt |
223 |
Q |
| |
|
|||||||||||||||||||||| | | ||||| ||| ||||||||||||||||||| || |||||||||||||||||||||||| ||| || |
|
|
| T |
15466132 |
ggctaaaatatggttttggtccttacggatatgcctcattttggttttagtccctgtaattttttgtttttgtttttggtccctgcaaatatgtctcgtt |
15466231 |
T |
 |
| Q |
224 |
ttggttttg |
232 |
Q |
| |
|
|| |||||| |
|
|
| T |
15466232 |
ttagttttg |
15466240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #156
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 17984332 - 17984389
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
17984332 |
aggctaaaatatggtttgagtccctgcaaatatgcctcgttttggttttagtctctgt |
17984389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #157
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 122 - 179
Target Start/End: Original strand, 30962414 - 30962471
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
30962414 |
taggctaaaatatggcattggtccctgcaaatatgtccagttttggttttagtccctg |
30962471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #158
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 127 - 176
Target Start/End: Original strand, 39025112 - 39025161
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
39025112 |
taaaatatggttttggtccctgcaaatatgtctcgttttgattttcgtcc |
39025161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #159
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 122 - 212
Target Start/End: Complemental strand, 41739122 - 41739035
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
41739122 |
taggctaaaatatggttttagtccctgcaaatat---tcgttttggttttagtccctgtaaatttttgtttttgtttttggtccctgcaaa |
41739035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #160
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 122 - 175
Target Start/End: Original strand, 48955712 - 48955765
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
175 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
48955712 |
taggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
48955765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #161
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 50428872 - 50428929
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||||||| ||||| ||||||| |
|
|
| T |
50428872 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttgcttttaatccctgt |
50428929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #162
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 123 - 176
Target Start/End: Original strand, 52254182 - 52254235
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
52254182 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtcc |
52254235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #163
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 124 - 180
Target Start/End: Complemental strand, 3679986 - 3679930
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
3679986 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccctgt |
3679930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #164
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 124 - 236
Target Start/End: Complemental strand, 15211858 - 15211744
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg--tnnnnnnnnnttattgtttttggtccctgcaaatatgcctca |
221 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||||| | |||||| || ||||||||||||| |||||||||| ||| |
|
|
| T |
15211858 |
ggctaaaatatggttttggtccttgcaaatatgcctcgttttggtttcaatccctgcaatttttttttttgttgtttttggtccttgcaaatatgtctcg |
15211759 |
T |
 |
| Q |
222 |
ttttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
15211758 |
ttttggttttggtcc |
15211744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #165
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 123 - 175
Target Start/End: Original strand, 16083046 - 16083098
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
175 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||| ||||||||| |
|
|
| T |
16083046 |
aggctaaaatatggttttagtccccgcaaatatgtctcgtttttgttttagtc |
16083098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #166
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 119 - 175
Target Start/End: Complemental strand, 17984706 - 17984650
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
175 |
Q |
| |
|
|||| |||||||||||| |||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
17984706 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
17984650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #167
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 133 - 235
Target Start/End: Complemental strand, 20949070 - 20948970
Alignment:
| Q |
133 |
atggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattttggttttg |
232 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||| ||||||||| ||| || ||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
20949070 |
atggttttggtctctgtaaatatgtctcgttttagttttagtc--tgtaaaatttttttgttgtttttggtccgtgcaaatatgtctcattttggttttg |
20948973 |
T |
 |
| Q |
233 |
gtc |
235 |
Q |
| |
|
||| |
|
|
| T |
20948972 |
gtc |
20948970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #168
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 120 - 176
Target Start/End: Complemental strand, 22919981 - 22919925
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||||| |||||||| |||||||||| |
|
|
| T |
22919981 |
tttaggctaaaatatggttttagtctctgcaaatatgcctcgttttagttttagtcc |
22919925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #169
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 124 - 176
Target Start/End: Original strand, 26191359 - 26191411
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
26191359 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtcc |
26191411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #170
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 123 - 171
Target Start/End: Original strand, 34002634 - 34002682
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttt |
171 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34002634 |
aggctaaagtatgattttggtccctgcaaatatgtctcgttttggtttt |
34002682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #171
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 129 - 180
Target Start/End: Original strand, 2939934 - 2939985
Alignment:
| Q |
129 |
aaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2939934 |
aaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctgt |
2939985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #172
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 125 - 180
Target Start/End: Original strand, 4323829 - 4323884
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||| |||||||| |||| |
|
|
| T |
4323829 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtctctgt |
4323884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #173
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 124 - 179
Target Start/End: Original strand, 12158690 - 12158745
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
12158690 |
ggctaaaatatggttttagtctctgcaaatatgcatcgttttggttttagtccctg |
12158745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #174
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 16026572 - 16026627
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
16026572 |
aggctaaaatataattttggtccctgcaaatatccctcgttttggttttagtccct |
16026627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #175
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 122 - 165
Target Start/End: Complemental strand, 32035790 - 32035747
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgtttt |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32035790 |
taggctaaaatatggttttggtccctgcaaatatgtcttgtttt |
32035747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #176
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 122 - 180
Target Start/End: Original strand, 4617086 - 4617144
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||| ||||||| ||||||||| |||| |
|
|
| T |
4617086 |
taggttaaaatatggttttggtccctgaaaatatgtttcgttttagttttagtctctgt |
4617144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #177
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 122 - 180
Target Start/End: Complemental strand, 7819105 - 7819047
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||| || ||||||||||| |||||||||||||||||| |||| |
|
|
| T |
7819105 |
taggctaaaatatggttttaatctctgcaaatatgcctcgttttggttttagtctctgt |
7819047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #178
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 142 - 180
Target Start/End: Original strand, 18302071 - 18302109
Alignment:
| Q |
142 |
gtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18302071 |
gtccctgcaaatatgtctcgttttggttttagtccctgt |
18302109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #179
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 124 - 174
Target Start/End: Complemental strand, 24510308 - 24510258
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
24510308 |
ggctaaaatatggttttggtccctgcaaatatggttcgttttagttttagt |
24510258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #180
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 26324874 - 26324832
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
26324874 |
ttttggtccctgcaaatatgtctcgttttggttttcgtccctg |
26324832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #181
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 193 - 235
Target Start/End: Original strand, 28507184 - 28507226
Alignment:
| Q |
193 |
ttgtttttggtccctgcaaatatgcctcattttggttttggtc |
235 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
28507184 |
ttgtttttggtccctgcaaatatgcctcgttttggttttggtc |
28507226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #182
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 130 - 176
Target Start/End: Original strand, 32035442 - 32035488
Alignment:
| Q |
130 |
aatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
32035442 |
aatatggttttgatctctgcaaatatgtctcgttttggttttagtcc |
32035488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #183
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 126 - 180
Target Start/End: Complemental strand, 45368847 - 45368793
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||| |||| ||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45368847 |
ctaaaatatgattttagtctctgcaaatatgcctcgttttggttttagtccctgt |
45368793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #184
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 126 - 176
Target Start/End: Complemental strand, 48730615 - 48730565
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||| |||||||||| |
|
|
| T |
48730615 |
ctaaaatatggttttggtccttgcaaatatgcctcgtttttgttttagtcc |
48730565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #185
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 122 - 180
Target Start/End: Complemental strand, 49923820 - 49923762
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||| |||||||| ||||||||||||| |
|
|
| T |
49923820 |
taggctaaaatatgattttggtctctgcaaatatgcttcgttttgattttagtccctgt |
49923762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #186
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 125 - 174
Target Start/End: Original strand, 7818783 - 7818832
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
174 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
7818783 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
7818832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #187
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 127 - 180
Target Start/End: Complemental strand, 15335292 - 15335239
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||| |||| ||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
15335292 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctgt |
15335239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #188
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 24978123 - 24978066
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||| ||||||||||||||||| ||||| |
|
|
| T |
24978123 |
aggctaaaatatagttttggtcctggcaaatatgcctcgttttggttttagttcctgt |
24978066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #189
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 122 - 175
Target Start/End: Complemental strand, 32906242 - 32906189
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
175 |
Q |
| |
|
|||| ||||||||| ||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
32906242 |
taggttaaaatatgattttggtccttgcaaatatgtctcgttttgattttagtc |
32906189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #190
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 123 - 176
Target Start/End: Original strand, 37624745 - 37624798
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||| |||||||||||||| |||| |
|
|
| T |
37624745 |
aggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttggtcc |
37624798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #191
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 119 - 180
Target Start/End: Complemental strand, 37625032 - 37624971
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||| |||||||||||||||| ||||||| |||||||| ||||||||||| ||||| |||| |
|
|
| T |
37625032 |
ttttaagctaaaatatggttttagtccctgtaaatatgtatcgttttggttgtagtctctgt |
37624971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #192
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 127 - 180
Target Start/End: Complemental strand, 46184051 - 46183998
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||| |||||||||| |||||||| |
|
|
| T |
46184051 |
taaaatatagttttggtccctgtaaatatgtctcattttggttttcgtccctgt |
46183998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #193
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 145 - 236
Target Start/End: Original strand, 24509963 - 24510054
Alignment:
| Q |
145 |
cctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| | |||||||||||||||||||||||| | | |||||||| |||||| |
|
|
| T |
24509963 |
cctgcaaatatgtttcgttttggttttagtccctgtaatttttttgttttgtttttggtccctgcaaatatgacgcgttttggttgtggtcc |
24510054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #194
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 127 - 179
Target Start/End: Complemental strand, 26062255 - 26062203
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||| ||||||||||||| |||| |
|
|
| T |
26062255 |
taaaatatggttttagtccctgtaaatatgtctcattttggttttagttcctg |
26062203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #195
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 123 - 171
Target Start/End: Complemental strand, 42483272 - 42483224
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttt |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
42483272 |
aggctaaaatatggttttggtccctgcaaatatgctttgttttggtttt |
42483224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #196
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 121 - 180
Target Start/End: Complemental strand, 4617398 - 4617339
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||| ||||||| || ||||||||| ||||||||||||||||| |||| |
|
|
| T |
4617398 |
ttaggctaaaatatgattttggttccaacaaatatgtttcgttttggttttagtctctgt |
4617339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #197
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 4789631 - 4789592
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4789631 |
ttttggtccctgcaaatatgcatcattttggttttggtcc |
4789592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #198
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 16060872 - 16060833
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
16060872 |
ttttggtccctgcaaatatgcctcattttggttttagtcc |
16060833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #199
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 123 - 166
Target Start/End: Complemental strand, 18079661 - 18079618
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttg |
166 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
18079661 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttg |
18079618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #200
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 121 - 180
Target Start/End: Complemental strand, 26699609 - 26699551
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| ||||||| ||||||||| |||| |
|
|
| T |
26699609 |
ttaggctaaaatatggttttggt-cctgcaaatatgcttcgtttttgttttagtctctgt |
26699551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #201
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 125 - 172
Target Start/End: Complemental strand, 33067729 - 33067682
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
172 |
Q |
| |
|
|||||||||| ||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
33067729 |
gctaaaatatcgttttagtccttgcaaatatgtctcgttttggtttta |
33067682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #202
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 3247489 - 3247447
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
3247489 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
3247447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #203
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 15211783 - 15211741
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
15211783 |
ttttggtccttgcaaatatgtctcgttttggttttggtccctg |
15211741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #204
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 16026865 - 16026823
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
16026865 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
16026823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #205
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 17130011 - 17129969
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
17130011 |
ttttggtccttgcaaatatgtctcgttttggttttggtccctg |
17129969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #206
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 19721001 - 19720959
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
19721001 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
19720959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #207
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 24507552 - 24507594
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
24507552 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
24507594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #208
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 118 - 180
Target Start/End: Original strand, 26142414 - 26142476
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| ||||| || | ||||||||| |||||||||||||||||| |||| |
|
|
| T |
26142414 |
attttaggctaaaatatagttttactctccgcaaatatgcctcgttttggttttagtcactgt |
26142476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #209
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 30323220 - 30323178
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
30323220 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
30323178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #210
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 31061078 - 31061036
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
31061078 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
31061036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #211
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 127 - 165
Target Start/End: Original strand, 31404429 - 31404467
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgtttt |
165 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
31404429 |
taaaatatgattttggtccctgcaaatatgtctcgtttt |
31404467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #212
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 33000596 - 33000554
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
33000596 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
33000554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #213
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 35056821 - 35056779
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
35056821 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
35056779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #214
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 38136908 - 38136866
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
38136908 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
38136866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #215
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 38150921 - 38150963
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
38150921 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
38150963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #216
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 38164004 - 38164046
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
38164004 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
38164046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #217
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 40718401 - 40718359
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
40718401 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
40718359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #218
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 45380345 - 45380387
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
45380345 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
45380387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #219
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 45638653 - 45638695
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
45638653 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
45638695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #220
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 47819305 - 47819347
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
47819305 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
47819347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #221
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 133 - 178
Target Start/End: Original strand, 292868 - 292913
Alignment:
| Q |
133 |
atggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
292868 |
atggttttagtccctgcaaatatgcctcgttttgcttttagtccct |
292913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #222
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 119 - 180
Target Start/End: Complemental strand, 16083403 - 16083343
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||| ||||||||| |||||||| |||| |
|
|
| T |
16083403 |
ttttaggctaaa-tatggttttagtccctgcaaatatacctcgttttgattttagtctctgt |
16083343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #223
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 195 - 236
Target Start/End: Original strand, 18208754 - 18208795
Alignment:
| Q |
195 |
gtttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
18208754 |
gtttttggtccctacaaatatgcctcgttttggttttggtcc |
18208795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #224
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 127 - 180
Target Start/End: Complemental strand, 21391371 - 21391318
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||| ||||||| ||||||| |||||||| ||||||||| |||| |
|
|
| T |
21391371 |
taaaatatggttttagtccctgtaaatatgcctcgttttagttttagtctctgt |
21391318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #225
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 137 - 178
Target Start/End: Original strand, 24977852 - 24977893
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
24977852 |
ttttggtccctgcaaatatgtctcattttggttttggtccct |
24977893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #226
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 119 - 180
Target Start/End: Original strand, 29579315 - 29579376
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||| ||||||||||||||| |||| |||||||||| ||| |||| ||||||||||||| |
|
|
| T |
29579315 |
ttttagactaaaatatggtttttgtccttgcaaatatgcctcattttaattttagtccctgt |
29579376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #227
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 124 - 180
Target Start/End: Complemental strand, 34383244 - 34383188
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||| |||| || |||| |||||||| | |||||||||||||||||||| |
|
|
| T |
34383244 |
ggctaaaatatgattttagttcctgtaaatatgtattgttttggttttagtccctgt |
34383188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #228
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 120 - 156
Target Start/End: Complemental strand, 39163087 - 39163051
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatg |
156 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
39163087 |
tttaggctaaaatatgcttttggtccctgcaaatatg |
39163051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #229
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 129 - 180
Target Start/End: Complemental strand, 4789639 - 4789588
Alignment:
| Q |
129 |
aaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||| ||||||||||||||||||||||| || |||||||||| |||||||| |
|
|
| T |
4789639 |
aaatttggttttggtccctgcaaatatgcatcattttggttttggtccctgt |
4789588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #230
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 125 - 180
Target Start/End: Original strand, 5058736 - 5058790
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||| | ||||| |||||||||||||| |
|
|
| T |
5058736 |
gctaaaatatgattttggtccatgcaaatatgt-tagttttagttttagtccctgt |
5058790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #231
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Original strand, 18079411 - 18079450
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
18079411 |
ttttggtccttgcaaatatgcctcattttggttttagtcc |
18079450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #232
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 24507830 - 24507791
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
24507830 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
24507791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #233
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Original strand, 24653815 - 24653854
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
24653815 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
24653854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #234
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Original strand, 26324598 - 26324637
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
26324598 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
26324637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #235
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 33045677 - 33045638
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
33045677 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
33045638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #236
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 125 - 180
Target Start/End: Original strand, 34382948 - 34383002
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||| ||||||||||||| |||| |
|
|
| T |
34382948 |
gctaaaatatggttttagtccctgcaaatatacctcg-tttggttttagtctctgt |
34383002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #237
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 38151199 - 38151160
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
38151199 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
38151160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #238
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 38164282 - 38164243
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
38164282 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
38164243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #239
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Original strand, 41738809 - 41738848
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
41738809 |
ttttggtccctgcaaatatgcctcattttagttttagtcc |
41738848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #240
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Original strand, 44157708 - 44157747
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
44157708 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
44157747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #241
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 45380623 - 45380584
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
45380623 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
45380584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #242
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 47819583 - 47819544
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
47819583 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
47819544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #243
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Original strand, 50799143 - 50799182
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
50799143 |
ttttagtccctgcaaatatgcctcattttggttttagtcc |
50799182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #244
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 4789381 - 4789423
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||| ||||||| |
|
|
| T |
4789381 |
ttttggtccccgcaaatatgtctcgttttgattttggtccctg |
4789423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #245
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 10631455 - 10631413
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||| ||||||| |
|
|
| T |
10631455 |
ttttggtctctgcaaatatgtctcattttggttttggtccctg |
10631413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #246
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 10887306 - 10887348
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||||| |
|
|
| T |
10887306 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
10887348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #247
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 12360676 - 12360718
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
12360676 |
ttttgatccctgcaaatatgtcccgttttggttttggtccctg |
12360718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #248
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 122 - 172
Target Start/End: Original strand, 15334915 - 15334965
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
172 |
Q |
| |
|
||||||||||||||||||| || ||| ||||||| ||||||||||||||| |
|
|
| T |
15334915 |
taggctaaaatatggttttaatctctgtaaatatgactcgttttggtttta |
15334965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #249
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 193 - 235
Target Start/End: Original strand, 18927846 - 18927888
Alignment:
| Q |
193 |
ttgtttttggtccctgcaaatatgcctcattttggttttggtc |
235 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
18927846 |
ttgtttttggtccctgcaaatatgtttcgttttggttttggtc |
18927888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #250
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 171
Target Start/End: Original strand, 18927850 - 18927884
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggtttt |
171 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |
|
|
| T |
18927850 |
ttttggtccctgcaaatatgtttcgttttggtttt |
18927884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #251
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 122 - 180
Target Start/End: Complemental strand, 21383430 - 21383372
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||| ||||| ||| |||||||||| ||| ||||| ||||||||||||| |
|
|
| T |
21383430 |
taggctaaaatatagttttaatccttgcaaatatgcctcattttgattttagtccctgt |
21383372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #252
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 126 - 176
Target Start/End: Original strand, 22953258 - 22953308
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||| ||||| |||| |||||||||||||| |||||| |||||||| |
|
|
| T |
22953258 |
ctaaaatatagttttagtccatgcaaatatgtctcattttggatttagtcc |
22953308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #253
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 124 - 178
Target Start/End: Original strand, 24609919 - 24609973
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| | |||| |||||| |||||| |
|
|
| T |
24609919 |
ggctaaaatatgtttttggtccctgcaaatatggcgagtttgggttttggtccct |
24609973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #254
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 118 - 180
Target Start/End: Original strand, 26244541 - 26244603
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||| | | ||||||||||||||||||| |
|
|
| T |
26244541 |
attttaggcttaaatatggaaatggtccctgcaaatatctgacattttggttttagtccctgt |
26244603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #255
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 171
Target Start/End: Original strand, 28507188 - 28507222
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggtttt |
171 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
28507188 |
ttttggtccctgcaaatatgcctcgttttggtttt |
28507222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #256
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 150 - 180
Target Start/End: Original strand, 32453956 - 32453986
Alignment:
| Q |
150 |
aaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
32453956 |
aaatatgtctcgttttggttttagtccctgt |
32453986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #257
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 33234620 - 33234662
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||| |||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
33234620 |
ttttgatccctgcaaatatgtctcgttttgattttggtccctg |
33234662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #258
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 197 - 235
Target Start/End: Original strand, 34002648 - 34002686
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtc |
235 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
34002648 |
ttttggtccctgcaaatatgtctcgttttggttttggtc |
34002686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #259
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 202 - 236
Target Start/End: Original strand, 37624764 - 37624798
Alignment:
| Q |
202 |
gtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |
|
|
| T |
37624764 |
gtccctgcaaatatgcctcgttttggttttggtcc |
37624798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #260
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 197 - 231
Target Start/End: Original strand, 42482992 - 42483026
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggtttt |
231 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
42482992 |
ttttggtccctgcaaatatgtctcattttggtttt |
42483026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #261
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 46183757 - 46183799
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||||| |
|
|
| T |
46183757 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
46183799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #262
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 119 - 156
Target Start/End: Complemental strand, 2604191 - 2604154
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatg |
156 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
2604191 |
ttttaggctaaaatatgtttttagtccctgcaaatatg |
2604154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #263
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 127 - 172
Target Start/End: Complemental strand, 4324163 - 4324118
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
172 |
Q |
| |
|
||||||||| |||| || | |||||||||||||||||||||||||| |
|
|
| T |
4324163 |
taaaatatgattttagttcatgcaaatatgtctcgttttggtttta |
4324118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #264
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 127 - 172
Target Start/End: Original strand, 4360299 - 4360343
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
172 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||| |||||||||||| |
|
|
| T |
4360299 |
taaaatatggttttagtcc-tgcaaatatgtcttgttttggtttta |
4360343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #265
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 197 - 238
Target Start/End: Original strand, 7350436 - 7350477
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcctt |
238 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
7350436 |
ttttagtccctgcaaatatgtctcattttggttttagtcctt |
7350477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #266
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 197 - 238
Target Start/End: Original strand, 11822017 - 11822058
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcctt |
238 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
11822017 |
ttttagtccctgcaaatatgcctcgttttggttttagtcctt |
11822058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #267
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 127 - 176
Target Start/End: Original strand, 20756022 - 20756071
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||| |||| ||| || ||||||||||||||||||||||||||| |
|
|
| T |
20756022 |
taaaatatgattttaatccttgtaaatatgtctcgttttggttttagtcc |
20756071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #268
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 122 - 155
Target Start/End: Complemental strand, 27264277 - 27264244
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatat |
155 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
27264277 |
taggctaaaatatgattttggtccctgcaaatat |
27264244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #269
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 124 - 176
Target Start/End: Complemental strand, 33380257 - 33380204
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccc-tgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||||||||| | ||| | |||||||| ||||||||||||||||||| |
|
|
| T |
33380257 |
ggctaaaatatggttttagccccctacaaatatgcctcgttttggttttagtcc |
33380204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #270
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 197 - 238
Target Start/End: Complemental strand, 35005731 - 35005690
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcctt |
238 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
35005731 |
ttttagtccctgcaaatatgcctcgttttggttttagtcctt |
35005690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #271
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 122 - 155
Target Start/End: Original strand, 35721099 - 35721132
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatat |
155 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
35721099 |
taggctaaaatatgtttttggtccctgcaaatat |
35721132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #272
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 46868225 - 46868282
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||| |||| |||| ||||||||||||||| || |||||||||||||| |||| |
|
|
| T |
46868225 |
aggctaaattatgattttagtccctgcaaatatgcttcattttggttttagtctctgt |
46868282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #273
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 123 - 156
Target Start/End: Original strand, 50164402 - 50164435
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatg |
156 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
50164402 |
aggctaaaatatgcttttggtccctgcaaatatg |
50164435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #274
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 137 - 178
Target Start/End: Complemental strand, 51986503 - 51986462
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
||||||||||||||||||||| |||||||| |||| |||||| |
|
|
| T |
51986503 |
ttttggtccctgcaaatatgtttcgttttgattttcgtccct |
51986462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #275
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 124 - 180
Target Start/End: Complemental strand, 1159839 - 1159783
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||| |||| || | ||||||| || || |||||||||||||||||||| |
|
|
| T |
1159839 |
ggctaaaatatgattttagttcttgcaaatgtgccttgttttggttttagtccctgt |
1159783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #276
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 123 - 155
Target Start/End: Complemental strand, 9774948 - 9774916
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatat |
155 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
9774948 |
aggctaaaatatgcttttggtccctgcaaatat |
9774916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #277
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 123 - 155
Target Start/End: Complemental strand, 17977619 - 17977587
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatat |
155 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |
|
|
| T |
17977619 |
aggcttaaatatggttttggtccctgcaaatat |
17977587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #278
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 123 - 155
Target Start/End: Complemental strand, 20723748 - 20723716
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatat |
155 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
20723748 |
aggctaaaatatgtttttggtccctgcaaatat |
20723716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #279
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 123 - 155
Target Start/End: Original strand, 27262907 - 27262939
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatat |
155 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
27262907 |
aggctaaaatatgtttttggtccctgcaaatat |
27262939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #280
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 123 - 155
Target Start/End: Complemental strand, 35911948 - 35911916
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatat |
155 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
35911948 |
aggctaaaatatgcttttggtccctgcaaatat |
35911916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #281
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 123 - 155
Target Start/End: Original strand, 37395632 - 37395664
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatat |
155 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
37395632 |
aggctaaaatatgtttttggtccctgcaaatat |
37395664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #282
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 123 - 155
Target Start/End: Complemental strand, 45979556 - 45979524
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatat |
155 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
45979556 |
aggctaaaatatgtttttggtccctgcaaatat |
45979524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #283
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 123 - 179
Target Start/End: Original strand, 47038865 - 47038921
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||| |||| |||||||||||||| || |||| |||||| ||||||| |
|
|
| T |
47038865 |
aggctaaaatatgtttttagtccctgcaaatatagctagtttgggttttggtccctg |
47038921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 78; Significance: 2e-36; HSPs: 213)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 120 - 236
Target Start/End: Complemental strand, 1105152 - 1105036
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcct |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
1105152 |
tttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgcct |
1105053 |
T |
 |
| Q |
220 |
cattttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
1105052 |
cattttggttttggtcc |
1105036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 116 - 236
Target Start/End: Complemental strand, 19565839 - 19565719
Alignment:
| Q |
116 |
tgattttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatat |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
19565839 |
tgattttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaatat |
19565740 |
T |
 |
| Q |
216 |
gcctcattttggttttggtcc |
236 |
Q |
| |
|
| ||||||||||||||||||| |
|
|
| T |
19565739 |
gtctcattttggttttggtcc |
19565719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 118 - 236
Target Start/End: Complemental strand, 4736548 - 4736430
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgc |
217 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || |||||||||||| |||||||||||| |
|
|
| T |
4736548 |
atttaaggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtctctgcaaatatgc |
4736449 |
T |
 |
| Q |
218 |
ctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |||| |
|
|
| T |
4736448 |
ctcattttggtttttgtcc |
4736430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 118 - 236
Target Start/End: Original strand, 40764409 - 40764527
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgc |
217 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
40764409 |
atttaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaagtttttttgttgtttttggtccctgcaaatatgt |
40764508 |
T |
 |
| Q |
218 |
ctcattttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
40764509 |
ctcattttggttttggtcc |
40764527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 123 - 236
Target Start/End: Complemental strand, 1381612 - 1381499
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||| ||||| |
|
|
| T |
1381612 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaattttttgttgtttttggtccctgcaaatatgtctcat |
1381513 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
1381512 |
tttggttttggtcc |
1381499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 123 - 236
Target Start/End: Original strand, 35928063 - 35928176
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||| ||||| |
|
|
| T |
35928063 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctcat |
35928162 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
35928163 |
tttggttttggtcc |
35928176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 123 - 236
Target Start/End: Complemental strand, 37271707 - 37271594
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||| || |||||||||||||||||||||||| ||||| |
|
|
| T |
37271707 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctcat |
37271608 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
37271607 |
tttggttttggtcc |
37271594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 122 - 236
Target Start/End: Original strand, 19685015 - 19685128
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctca |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||| |||||||||||| |||| |
|
|
| T |
19685015 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttgttgtttttggt-cctgcaaatatgtctca |
19685113 |
T |
 |
| Q |
222 |
ttttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
19685114 |
ttttggttttggtcc |
19685128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 123 - 236
Target Start/End: Original strand, 24443379 - 24443492
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| || |||||||||||||||||||||||| ||||| |
|
|
| T |
24443379 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaatatgtctcat |
24443478 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
24443479 |
tttggttttggtcc |
24443492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 123 - 236
Target Start/End: Original strand, 35876687 - 35876800
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||| || |||||||||||||||||||||||| ||||| |
|
|
| T |
35876687 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgtctcat |
35876786 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
35876787 |
tttggttttggtcc |
35876800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 124 - 236
Target Start/End: Original strand, 2636669 - 2636781
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcatt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||| ||| || ||||||||||||||||||||||||||| ||| |
|
|
| T |
2636669 |
ggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtctctgcaaaaaaaatttgttgtttttggtccctgcaaatatgccttatt |
2636768 |
T |
 |
| Q |
224 |
ttggttttggtcc |
236 |
Q |
| |
|
||||||||||||| |
|
|
| T |
2636769 |
ttggttttggtcc |
2636781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 120 - 233
Target Start/End: Original strand, 32108804 - 32108916
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcct |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| |||||| ||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
32108804 |
tttaggctaaaatatggttttggtccctgcaaatatgtttcgttttagttttaatccctgt-aaaaaaaattgttgtttttggtccctgcaaatatgcct |
32108902 |
T |
 |
| Q |
220 |
cattttggttttgg |
233 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
32108903 |
cattttggttttgg |
32108916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 123 - 236
Target Start/End: Complemental strand, 5917461 - 5917347
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgc-aaatatgcctca |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || ||||||||||||||||| ||||||| |||| |
|
|
| T |
5917461 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatatgtctca |
5917362 |
T |
 |
| Q |
222 |
ttttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
5917361 |
ttttggttttggtcc |
5917347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 124 - 236
Target Start/End: Original strand, 6912497 - 6912610
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg-tnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||| ||||| |
|
|
| T |
6912497 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaaatttgttgtttttggtccctgcaaatatgtctcat |
6912596 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
6912597 |
tttggttttggtcc |
6912610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 127 - 232
Target Start/End: Original strand, 20985728 - 20985833
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattttg |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||| ||||||||| |
|
|
| T |
20985728 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaatatgtctcattttg |
20985827 |
T |
 |
| Q |
227 |
gttttg |
232 |
Q |
| |
|
|||||| |
|
|
| T |
20985828 |
gttttg |
20985833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 123 - 235
Target Start/End: Original strand, 28213372 - 28213484
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| ||||||||||||||| ||| || || ||||||||||||||||||||||||| | |
|
|
| T |
28213372 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccatgtaatttttttttgttatttttggtccctgcaaatatgcctcgt |
28213471 |
T |
 |
| Q |
223 |
tttggttttggtc |
235 |
Q |
| |
|
||||||||||||| |
|
|
| T |
28213472 |
tttggttttggtc |
28213484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 116 - 212
Target Start/End: Complemental strand, 35877060 - 35876964
Alignment:
| Q |
116 |
tgattttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || |||||||||||||||||||| |
|
|
| T |
35877060 |
tgattttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagcccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
35876964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 124 - 236
Target Start/End: Original strand, 36973353 - 36973465
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcatt |
223 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||||| | ||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
36973353 |
ggctaaaatatggttttggtctctccaaatatgtctcgttttggttttagttcatgtaaaaaatatttgttgtttttggtccctgcaaatatgcctcatt |
36973452 |
T |
 |
| Q |
224 |
ttggttttggtcc |
236 |
Q |
| |
|
||| ||||||||| |
|
|
| T |
36973453 |
ttgattttggtcc |
36973465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 127 - 236
Target Start/End: Complemental strand, 1287042 - 1286935
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattttg |
226 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||||| ||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
1287042 |
taaaatatggttttggtccctgtaaatatgtctcattttggttttagttcctgtaatttttgttt--tgtttttggtccctgcaaatatgcctcattttg |
1286945 |
T |
 |
| Q |
227 |
gttttggtcc |
236 |
Q |
| |
|
|||||||||| |
|
|
| T |
1286944 |
gttttggtcc |
1286935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 122 - 232
Target Start/End: Original strand, 20690731 - 20690840
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctca |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| || |||||||||||||||||||||||| ||| |
|
|
| T |
20690731 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgtaattttttttt-ttgtttttggtccctgcaaatatgtctcg |
20690829 |
T |
 |
| Q |
222 |
ttttggttttg |
232 |
Q |
| |
|
|||| |||||| |
|
|
| T |
20690830 |
ttttagttttg |
20690840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 123 - 212
Target Start/End: Original strand, 1381246 - 1381335
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
1381246 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
1381335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 122 - 179
Target Start/End: Original strand, 5917124 - 5917181
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5917124 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
5917181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 124 - 212
Target Start/End: Original strand, 30888160 - 30888248
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
30888160 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtagaattttttttttgtttttggtccctgcaaa |
30888248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 128 - 236
Target Start/End: Original strand, 32888691 - 32888799
Alignment:
| Q |
128 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattttgg |
227 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||||||||||||| || ||||||||||||||||||||||||||| |||||| |
|
|
| T |
32888691 |
aaaatatggttttggtccctgcaaatattcctcgttttcgttttagtccctgtaatttttttttgttgtttttggtccctgcaaatatgccttgttttgg |
32888790 |
T |
 |
| Q |
228 |
ttttggtcc |
236 |
Q |
| |
|
||||||||| |
|
|
| T |
32888791 |
ttttggtcc |
32888799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 124 - 212
Target Start/End: Complemental strand, 35928458 - 35928370
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
35928458 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
35928370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 124 - 180
Target Start/End: Original strand, 45138 - 45194
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45138 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
45194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 123 - 179
Target Start/End: Original strand, 19565466 - 19565522
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19565466 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
19565522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 123 - 230
Target Start/End: Original strand, 38170513 - 38170620
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || |||||||||||||||| ||||||| ||| | |
|
|
| T |
38170513 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaattttttttgttgtttttggtccctggaaatatgtctcgt |
38170612 |
T |
 |
| Q |
223 |
tttggttt |
230 |
Q |
| |
|
||| |||| |
|
|
| T |
38170613 |
ttttgttt |
38170620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 122 - 212
Target Start/End: Complemental strand, 24443746 - 24443656
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
24443746 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
24443656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 126 - 180
Target Start/End: Complemental strand, 6912855 - 6912801
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6912855 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
6912801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 123 - 212
Target Start/End: Complemental strand, 19685381 - 19685292
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
19685381 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
19685292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 123 - 236
Target Start/End: Original strand, 20660947 - 20661060
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| | ||||||||||||| |||| ||||| ||| | |
|
|
| T |
20660947 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccttgtaaaaaaaatgtgttgtttttggtccttgcagatatgtctcgt |
20661046 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
20661047 |
tttggttttggtcc |
20661060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 122 - 180
Target Start/End: Original strand, 36577720 - 36577778
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36577720 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
36577778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 120 - 212
Target Start/End: Original strand, 1104854 - 1104946
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||| || |||||||||||||||||||| |
|
|
| T |
1104854 |
tttaggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
1104946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 119 - 180
Target Start/End: Original strand, 5950171 - 5950232
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5950171 |
ttttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
5950232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 123 - 176
Target Start/End: Complemental strand, 18258528 - 18258475
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18258528 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
18258475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 26133414 - 26133357
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26133414 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
26133357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 119 - 180
Target Start/End: Original strand, 29692739 - 29692800
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29692739 |
ttttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
29692800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 125 - 232
Target Start/End: Complemental strand, 9588611 - 9588504
Alignment:
| Q |
125 |
gctaaaatatggtttt-ggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcatt |
223 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||||||||||||||||| ||| || |||||||||||| |||||||||||||||||| |
|
|
| T |
9588611 |
gctaaaatatgatttttggtccctgcaaatatgtctcgttttggttttagtccatgt-aaatttttttgttgtttttggtctctgcaaatatgcctcatt |
9588513 |
T |
 |
| Q |
224 |
ttggttttg |
232 |
Q |
| |
|
||||||||| |
|
|
| T |
9588512 |
ttggttttg |
9588504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 119 - 179
Target Start/End: Complemental strand, 29875730 - 29875670
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29875730 |
ttttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
29875670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 121 - 212
Target Start/End: Original strand, 37271356 - 37271447
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
37271356 |
ttaggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
37271447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 121 - 180
Target Start/End: Complemental strand, 4203773 - 4203714
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4203773 |
ttaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt |
4203714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 123 - 232
Target Start/End: Original strand, 18258161 - 18258271
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg-tnnnnnnnnnttattgtttttggtccctgcaaatatgcctca |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| || |||||||||| ||||||||||||| |||| |
|
|
| T |
18258161 |
aggctaaaatatggttttggtccctgcaaatatggctcattttggttttagtccctgcaaaaaaaaaattgttgtttttggcccctgcaaatatgtctca |
18258260 |
T |
 |
| Q |
222 |
ttttggttttg |
232 |
Q |
| |
|
||||||||||| |
|
|
| T |
18258261 |
ttttggttttg |
18258271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 127 - 235
Target Start/End: Complemental strand, 45501 - 45392
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg-tnnnnnnnnnttattgtttttggtccctgcaaatatgcctcatttt |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| || ||| || |||||||||||||||||||||||| |||||||| |
|
|
| T |
45501 |
taaaatatggttttggtccctgcaaatatgtttcgttttggttttaatctctgcaaaaaaaaaattgttgtttttggtccctgcaaatatgtctcatttt |
45402 |
T |
 |
| Q |
226 |
ggttttggtc |
235 |
Q |
| |
|
|||||||||| |
|
|
| T |
45401 |
ggttttggtc |
45392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 122 - 180
Target Start/End: Complemental strand, 10744056 - 10743998
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
10744056 |
taggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccctgt |
10743998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 119 - 236
Target Start/End: Original strand, 15916281 - 15916398
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcc |
218 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||||||| ||||||||||||||||| | || | ||||||||||| | |||||||| | |
|
|
| T |
15916281 |
tttttggctaaaagatggttttggtccctgcaaatatgtctcattttggttttagtccctataatttttttttgtagtttttggtccttacaaatatgtc |
15916380 |
T |
 |
| Q |
219 |
tcattttggttttggtcc |
236 |
Q |
| |
|
|| ||||||||||||||| |
|
|
| T |
15916381 |
tcgttttggttttggtcc |
15916398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 122 - 180
Target Start/End: Original strand, 24781987 - 24782045
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
24781987 |
taggctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtccctgt |
24782045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 118 - 180
Target Start/End: Complemental strand, 28863844 - 28863782
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28863844 |
atttttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
28863782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 122 - 180
Target Start/End: Original strand, 30800492 - 30800550
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30800492 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
30800550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 122 - 180
Target Start/End: Complemental strand, 30800852 - 30800794
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30800852 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
30800794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 2217493 - 2217550
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2217493 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
2217550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 122 - 179
Target Start/End: Complemental strand, 3850601 - 3850544
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3850601 |
taggctgaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
3850544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 119 - 180
Target Start/End: Complemental strand, 5614535 - 5614474
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
5614535 |
ttttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt |
5614474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 7075571 - 7075628
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7075571 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
7075628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 119 - 176
Target Start/End: Original strand, 14318040 - 14318097
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
14318040 |
ttttaggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtcc |
14318097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 18046037 - 18046094
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
18046037 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgt |
18046094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 21124912 - 21124969
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21124912 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgt |
21124969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 28863509 - 28863566
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28863509 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
28863566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 121 - 236
Target Start/End: Original strand, 28871634 - 28871750
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt-nnnnnnnnnttattgtttttggtccctgcaaatatgcct |
219 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||| || |
|
|
| T |
28871634 |
ttaggttaaaatatgattttggtccctgcaaatatccttcgttttggttttagtccctgtaaaaaaaaaattgttgtttttggtccctgcaaatatgtct |
28871733 |
T |
 |
| Q |
220 |
cattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
28871734 |
cattttggttttagtcc |
28871750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 118 - 179
Target Start/End: Complemental strand, 35166164 - 35166103
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
35166164 |
attttaggctataatatggttttagtccctgcaaaaatgtctcgttttggttttagtccctg |
35166103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 36578084 - 36578027
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36578084 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
36578027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 124 - 212
Target Start/End: Complemental strand, 36973710 - 36973622
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||| || |||||||||||||||||||| |
|
|
| T |
36973710 |
ggctaaaatatggttttggtccctggaaatatgtctcgttttgattttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
36973622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 118 - 238
Target Start/End: Original strand, 42596447 - 42596567
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgc |
217 |
Q |
| |
|
|||| ||||||||||||||||||| |||| |||||||| ||| |||||||||||||| ||||| | |||||||||||| |||||||||||| |
|
|
| T |
42596447 |
atttaaggctaaaatatggttttgatcccagcaaatatatcttgttttggttttagttcctgtaatttttttgttttgtttttggtcactgcaaatatgc |
42596546 |
T |
 |
| Q |
218 |
ctcattttggttttggtcctt |
238 |
Q |
| |
|
||| ||||| ||||||||||| |
|
|
| T |
42596547 |
ctcgttttgattttggtcctt |
42596567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 123 - 233
Target Start/End: Original strand, 17070534 - 17070644
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt-nnnnnnnnnttattgtttttggtccctgcaaatatgcctca |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||| |||| |||||||||||||| ||||||| ||| |
|
|
| T |
17070534 |
aggctaaaatatggttttggtccctgcaaatatgtctcg-tttgattttagtccctgtaaaaaaaaatttatagtttttggtccctgtaaatatggctcg |
17070632 |
T |
 |
| Q |
222 |
ttttggttttgg |
233 |
Q |
| |
|
|||||||||||| |
|
|
| T |
17070633 |
ttttggttttgg |
17070644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 123 - 179
Target Start/End: Original strand, 18633598 - 18633654
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
18633598 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
18633654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 20986090 - 20986034
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
20986090 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg |
20986034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 124 - 180
Target Start/End: Original strand, 28550827 - 28550883
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28550827 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
28550883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 29172887 - 29172831
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29172887 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
29172831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 124 - 180
Target Start/End: Complemental strand, 29366949 - 29366893
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
29366949 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgt |
29366893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 120 - 172
Target Start/End: Complemental strand, 31037745 - 31037693
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
172 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
31037745 |
tttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
31037693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 124 - 180
Target Start/End: Complemental strand, 33336026 - 33335970
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33336026 |
ggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctgt |
33335970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 35167166 - 35167110
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35167166 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
35167110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 126 - 174
Target Start/End: Complemental strand, 35609635 - 35609587
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35609635 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
35609587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 38496783 - 38496727
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
38496783 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctg |
38496727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 124 - 180
Target Start/End: Complemental strand, 40029497 - 40029441
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40029497 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
40029441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 122 - 236
Target Start/End: Original strand, 40038492 - 40038607
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt-nnnnnnnnnttattgtttttggtccctgcaaatatgcctc |
220 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||| ||||| ||| ||| || |||||||||||||||||||||||||||| |
|
|
| T |
40038492 |
taggctaaaatatggttttgatccctgcaaatatgcctcgttttgattttaatccgtgtaatttttttgtttttgtttttggtccctgcaaatatgcctc |
40038591 |
T |
 |
| Q |
221 |
attttggttttggtcc |
236 |
Q |
| |
|
||||| ||||||||| |
|
|
| T |
40038592 |
attttcattttggtcc |
40038607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 40764781 - 40764725
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40764781 |
aggctaaaatatggttttgctccctgcaaatatgcctcgttttggttttagtccctg |
40764725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 124 - 180
Target Start/End: Original strand, 42553642 - 42553698
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42553642 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtctctgt |
42553698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 2217855 - 2217800
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2217855 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
2217800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 125 - 176
Target Start/End: Complemental strand, 2636992 - 2636941
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2636992 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
2636941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 122 - 236
Target Start/End: Original strand, 10830527 - 10830641
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctca |
221 |
Q |
| |
|
||||||||||||||||||||||| || |||||||| || |||||||||||||| ||||| || ||||||||||| ||||||||||| ||| |
|
|
| T |
10830527 |
taggctaaaatatggttttggtctcttcaaatatgcctagttttggttttagttcctgtaattttttgtttttgtttttggttgctgcaaatatggctcg |
10830626 |
T |
 |
| Q |
222 |
ttttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
10830627 |
ttttggttttggtcc |
10830641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 121 - 176
Target Start/End: Complemental strand, 18046351 - 18046296
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
18046351 |
ttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
18046296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 119 - 212
Target Start/End: Complemental strand, 20661316 - 20661223
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||| |||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
20661316 |
tttttggctaaaatatggttttggtccgtgcaaatatgcttcgttttggttttagtccctgtaaattttttttgttgtttttggtccctgcaaa |
20661223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 122 - 180
Target Start/End: Original strand, 23381948 - 23382006
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
23381948 |
taggctaaaatatggttttagtccctgcaaatatgtctggttttggttttagttcctgt |
23382006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 125 - 179
Target Start/End: Original strand, 29172524 - 29172578
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29172524 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
29172578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 118 - 180
Target Start/End: Original strand, 40029135 - 40029197
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||| |||||||||||||||||| ||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
40029135 |
atttaaggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttaatccctgt |
40029197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 122 - 180
Target Start/End: Complemental strand, 40168010 - 40167952
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||| ||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
40168010 |
taggctaaaatattgttttagtccatgcaaatatgtctcgttttggttttagtccctgt |
40167952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 122 - 180
Target Start/End: Original strand, 42207240 - 42207298
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||| |||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
42207240 |
taggctaaaatatggttttagtccttgtaaatatgtctcgttttggttttagtccctgt |
42207298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 176
Target Start/End: Original strand, 5614165 - 5614218
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
5614165 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc |
5614218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 118 - 179
Target Start/End: Complemental strand, 6118505 - 6118444
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
6118505 |
atttttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctg |
6118444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 176
Target Start/End: Original strand, 10743723 - 10743776
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10743723 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
10743776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 11799459 - 11799402
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
11799459 |
aggctaaaatatggttttagtccgtgcaaatatgcctcgttttggttttagtccctgt |
11799402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 176
Target Start/End: Original strand, 16038376 - 16038429
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
16038376 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
16038429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 26071290 - 26071347
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
26071290 |
aggctaaaatatagtttcggtccctgcaaatatgtctcattttggttttagtccctgt |
26071347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 127 - 180
Target Start/End: Complemental strand, 26071613 - 26071560
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26071613 |
taaaatatgattttgatccctgcaaatatgtctcgttttggttttagtccctgt |
26071560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 127 - 180
Target Start/End: Complemental strand, 28108159 - 28108106
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
28108159 |
taaaatatggttttggtccctacaaatatgcctcgttttggttttagtccctgt |
28108106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 28871995 - 28871938
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
28871995 |
aggctaaattatggttttggtccctgcaaatatgcctcgttttggttttagttcctgt |
28871938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 119 - 176
Target Start/End: Original strand, 34125302 - 34125359
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34125302 |
ttttaggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
34125359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 38786158 - 38786215
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38786158 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgt |
38786215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 40167785 - 40167842
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40167785 |
aggctaaagtatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
40167842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 127 - 180
Target Start/End: Complemental strand, 42596814 - 42596761
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
42596814 |
taaaatatggttttggtccctgcaaatatgactcgttttagttttagtccctgt |
42596761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 124 - 180
Target Start/End: Original strand, 1286682 - 1286738
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
1286682 |
ggctaaaatatggtgttggtccctacaaatatgcctcgttttggttttagtccctgt |
1286738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 124 - 176
Target Start/End: Complemental strand, 2032940 - 2032888
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2032940 |
ggctaaattatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
2032888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 123 - 179
Target Start/End: Original strand, 10408927 - 10408983
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
10408927 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
10408983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 119 - 175
Target Start/End: Complemental strand, 10409331 - 10409275
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
175 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||||||| |||||||| |
|
|
| T |
10409331 |
ttttaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc |
10409275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 15635708 - 15635652
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
15635708 |
aggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctg |
15635652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 124 - 180
Target Start/End: Original strand, 26133183 - 26133239
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| |||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
26133183 |
ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgt |
26133239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 124 - 180
Target Start/End: Original strand, 35609303 - 35609359
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
35609303 |
ggctaaaatatggttttggtccatgcaaatatgcatcgttttggttttagtccctgt |
35609359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 122 - 238
Target Start/End: Complemental strand, 38555085 - 38554972
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctca |
221 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||| ||||||||||||||||| | || ||||||||| ||||||||| |||| ||| |
|
|
| T |
38555085 |
taggctaaaatatggttt-ggtccctgcaaatatgcctcattttggttttagtccctct--aaaaaaattgttgtttttgatccctgcaattatgtctcg |
38554989 |
T |
 |
| Q |
222 |
ttttggttttggtcctt |
238 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
38554988 |
ttttggttttggtcctt |
38554972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 120 - 176
Target Start/End: Complemental strand, 39379614 - 39379558
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
39379614 |
tttaggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtcc |
39379558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 123 - 174
Target Start/End: Original strand, 4203455 - 4203506
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
174 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
4203455 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
4203506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 121 - 180
Target Start/End: Original strand, 5904005 - 5904064
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||| ||||||||| ||||||||||||| |
|
|
| T |
5904005 |
ttaggctaaaatatggttttgctccttgcaaatatgcctcgttttgattttagtccctgt |
5904064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 124 - 179
Target Start/End: Complemental strand, 18633961 - 18633906
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
18633961 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttactccctg |
18633906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 124 - 179
Target Start/End: Original strand, 25561705 - 25561760
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
25561705 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctg |
25561760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 118 - 212
Target Start/End: Complemental strand, 40038864 - 40038770
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||| || |||||||||||| ||||||| || |||||||||||||||||||| |
|
|
| T |
40038864 |
atttttggctaaaatatgattttggtccctgcaaatatgccttgttttggttttaatccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
40038770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 122 - 180
Target Start/End: Complemental strand, 3851331 - 3851273
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
3851331 |
taggctaaaatatggttttagtccctcaaaatatgtctcgttttgattttagtccctgt |
3851273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 124 - 174
Target Start/End: Complemental strand, 5104001 - 5103951
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
174 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
5104001 |
ggctaaaatatggttttggttcctgcaaatatgtctcattttggttttagt |
5103951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 122 - 180
Target Start/End: Original strand, 12144905 - 12144963
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||| ||| ||||||||||||||||||| |
|
|
| T |
12144905 |
taggctaaaatatggtttttgtccctgtaaatatgcctctttttggttttagtccctgt |
12144963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 118 - 176
Target Start/End: Complemental strand, 13990901 - 13990843
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||| ||||||||||| |||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
13990901 |
atttaaggctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
13990843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 122 - 180
Target Start/End: Complemental strand, 17070865 - 17070807
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||||||| ||||||| |||||| |
|
|
| T |
17070865 |
taggctaaaatatggttttagtccctacaaatatgtctcgttttcgttttagaccctgt |
17070807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 123 - 177
Target Start/End: Original strand, 20416359 - 20416413
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
177 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |||||||| |||||| |
|
|
| T |
20416359 |
aggctaaaatatggttttcgtccctgcaaatatgtctcgctttggtttaagtccc |
20416413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #122
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 122 - 172
Target Start/End: Complemental strand, 25562001 - 25561951
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
172 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
25562001 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
25561951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #123
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 126 - 172
Target Start/End: Complemental strand, 38452394 - 38452348
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38452394 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttgatttta |
38452348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #124
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 124 - 174
Target Start/End: Original strand, 38962806 - 38962856
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
174 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
38962806 |
ggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagt |
38962856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #125
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 123 - 176
Target Start/End: Original strand, 293827 - 293880
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
293827 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtcc |
293880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #126
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 9179592 - 9179649
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
9179592 |
aggctaaaatatggttttagtccttgcaaatatgattcgttttggttttagtccctgt |
9179649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #127
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 9179921 - 9179864
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| ||||||||||||||| ||||||| |
|
|
| T |
9179921 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttattccctgt |
9179864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #128
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 126 - 171
Target Start/End: Complemental strand, 12145181 - 12145136
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttt |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
12145181 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttgatttt |
12145136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #129
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 34125633 - 34125576
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| ||| ||||||||||||||||||| |
|
|
| T |
34125633 |
aggctaaaatatggttttagtccctgtaaatatgcctcattttggttttagtccctgt |
34125576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #130
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 119 - 176
Target Start/End: Original strand, 36278076 - 36278133
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| || |||| |||||||||| |
|
|
| T |
36278076 |
ttttaggctaaaatatggttttgatccctgcaaatatgtttcattttagttttagtcc |
36278133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #131
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 122 - 179
Target Start/End: Original strand, 39379237 - 39379294
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||| ||||||||| |||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
39379237 |
taggttaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
39379294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #132
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 120 - 168
Target Start/End: Original strand, 4736201 - 4736249
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggt |
168 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4736201 |
tttaggctaaaatatggttttggtctttgcaaatatgtctcgttttggt |
4736249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #133
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 123 - 179
Target Start/End: Original strand, 11799128 - 11799184
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
11799128 |
aggctaaaatatggttttagtccctgcaaatatgcattgttttggttttagtccctg |
11799184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #134
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 127 - 179
Target Start/End: Original strand, 15635379 - 15635431
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
15635379 |
taaaatatggttttagtccatgcaaatatgtcttgttttggttttagtccctg |
15635431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #135
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 124 - 180
Target Start/End: Complemental strand, 21050913 - 21050857
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
21050913 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttgattttagtccctgt |
21050857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #136
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 124 - 176
Target Start/End: Complemental strand, 23382297 - 23382245
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| || |||||||||||||||| |
|
|
| T |
23382297 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtcc |
23382245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #137
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 126 - 178
Target Start/End: Complemental strand, 27850372 - 27850320
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
|||||||||| |||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
27850372 |
ctaaaatatgattttagtctctgcaaatatgtctcgttttggttttagtccct |
27850320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #138
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 29151852 - 29151796
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||||||||| |||| |
|
|
| T |
29151852 |
aggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagttcctg |
29151796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #139
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 123 - 179
Target Start/End: Original strand, 29875399 - 29875455
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||| |||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29875399 |
aggctaaaatatgattttaatccctgcaaatatgcctcgttttggttttagtccctg |
29875455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #140
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 121 - 180
Target Start/End: Original strand, 38554748 - 38554805
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
38554748 |
ttaggctaaaatatggttttgatccctgcaaata--tctcgttttggttttagtctctgt |
38554805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #141
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 118 - 180
Target Start/End: Original strand, 3850293 - 3850356
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttgg-ttttagtccctgt |
180 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||| || |||||||||| ||||||||||||| |
|
|
| T |
3850293 |
atttttggctaaaatatggttttagtccctgcaaatctgcctcgttttggtttttagtccctgt |
3850356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #142
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 121 - 180
Target Start/End: Complemental strand, 25779165 - 25779106
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| || ||||||||||||| ||||| |
|
|
| T |
25779165 |
ttaggctaaaatatggttttagtccctgcaaatatgcttcattttggttttagttcctgt |
25779106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #143
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 124 - 179
Target Start/End: Original strand, 29151516 - 29151571
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
29151516 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccctg |
29151571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #144
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 118 - 173
Target Start/End: Original strand, 35166905 - 35166960
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttag |
173 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||| || ||||||||||||| |
|
|
| T |
35166905 |
atttaaggctaaaatatggttttagtccctgcaaatatgccttgttttggttttag |
35166960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #145
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 123 - 170
Target Start/End: Complemental strand, 38182088 - 38182041
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
170 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38182088 |
aggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38182041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #146
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 123 - 170
Target Start/End: Original strand, 38189043 - 38189090
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
170 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38189043 |
aggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38189090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #147
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 123 - 170
Target Start/End: Complemental strand, 38209314 - 38209267
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
170 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38209314 |
aggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38209267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #148
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 123 - 170
Target Start/End: Original strand, 38216268 - 38216315
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
170 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38216268 |
aggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38216315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #149
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 126 - 180
Target Start/End: Complemental strand, 16038738 - 16038684
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||| |||| ||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
16038738 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtctctgt |
16038684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #150
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 118 - 180
Target Start/End: Original strand, 27916455 - 27916517
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||| ||||||||||| | || || ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
27916455 |
attttatgctaaaatatgatcttagttcctgcaaatatgtttcgttttggttttagtccctgt |
27916517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #151
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 28871711 - 28871753
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
28871711 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
28871753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #152
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 137 - 175
Target Start/End: Original strand, 31602221 - 31602259
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtc |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31602221 |
ttttggtccctgcaaatatgtctcgttttggttttagtc |
31602259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #153
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 118 - 172
Target Start/End: Original strand, 42994062 - 42994116
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
172 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||| ||||||||| ||||| |
|
|
| T |
42994062 |
atttttggctaaaatatggttttagtccctgcaaatatgactcgttttgatttta |
42994116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #154
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 127 - 176
Target Start/End: Complemental strand, 9532532 - 9532483
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||||||||||||| |
|
|
| T |
9532532 |
taaaatatggttttagtccttgcaaatatgcctcgttttggttttagtcc |
9532483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #155
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 20683746 - 20683803
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||| |||||||| ||||||||||||| |
|
|
| T |
20683746 |
aggctaaaatatggttttagtctctgcaaatatgcatcgttttgattttagtccctgt |
20683803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #156
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 126 - 175
Target Start/End: Complemental strand, 20691094 - 20691045
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
175 |
Q |
| |
|
|||||||||| ||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
20691094 |
ctaaaatatgattttggttcctgcaaatatggctcgttttggttttagtc |
20691045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #157
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 127 - 180
Target Start/End: Complemental strand, 27916761 - 27916708
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
27916761 |
taaaatatggttttattccctgcaaatatgcctcgttttggttttagtctctgt |
27916708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #158
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 123 - 176
Target Start/End: Complemental strand, 29693091 - 29693038
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
29693091 |
aggctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagtcc |
29693038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #159
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 196 - 240
Target Start/End: Complemental strand, 10830884 - 10830840
Alignment:
| Q |
196 |
tttttggtccctgcaaatatgcctcattttggttttggtcctttg |
240 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
10830884 |
tttttggtccctgcaaatatgccttattttggttttagtcctttg |
10830840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #160
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 123 - 174
Target Start/End: Complemental strand, 18286742 - 18286691
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
174 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
18286742 |
aggctaaaaaatggttttagtccctgcaaatatacctcgttttggttttagt |
18286691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #161
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 118 - 177
Target Start/End: Complemental strand, 20418022 - 20417963
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccc |
177 |
Q |
| |
|
||||||| ||||||||||||| ||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
20418022 |
attttagaataaaatatggtttaagtctctgcaaatatgtctcgttttgattttagtccc |
20417963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #162
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 197 - 236
Target Start/End: Original strand, 28213386 - 28213425
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28213386 |
ttttggtccctgcaaatatgcctcattttggttttagtcc |
28213425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #163
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 125 - 180
Target Start/End: Original strand, 29855614 - 29855669
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||| ||||||||| || ||||||| ||| ||||||||||||||||||| |
|
|
| T |
29855614 |
gctaaaatatgattttggtccttggaaatatgcctcattttggttttagtccctgt |
29855669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #164
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 1381538 - 1381496
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
1381538 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
1381496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #165
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 6912571 - 6912613
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
6912571 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
6912613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #166
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 122 - 172
Target Start/End: Original strand, 18286426 - 18286476
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
172 |
Q |
| |
|
|||| |||||||||||||| || ||||||||||||||| |||||||||||| |
|
|
| T |
18286426 |
taggttaaaatatggttttagttcctgcaaatatgtcttgttttggtttta |
18286476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #167
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 19565758 - 19565716
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
19565758 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
19565716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #168
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 24443453 - 24443495
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
24443453 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
24443495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #169
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 122 - 180
Target Start/End: Complemental strand, 32109098 - 32109041
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||| ||||| |||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
32109098 |
taggctaatatatgattttggtcg-tgcaaatatgtttcgttttggttttagtccctgt |
32109041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #170
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 35876761 - 35876803
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
35876761 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
35876803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #171
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 35928137 - 35928179
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
35928137 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
35928179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #172
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 37271633 - 37271591
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
37271633 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
37271591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #173
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 40764488 - 40764530
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
40764488 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
40764530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #174
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 126 - 180
Target Start/End: Complemental strand, 42207570 - 42207517
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||| |||| | |||||||| ||||||||||||||||||||||| |
|
|
| T |
42207570 |
ctaaaatatggttttagtcc-tacaaatatgcctcgttttggttttagtccctgt |
42207517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #175
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 126 - 175
Target Start/End: Original strand, 16616370 - 16616419
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
175 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||| |||| ||||||||| |
|
|
| T |
16616370 |
ctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtc |
16616419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #176
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 197 - 238
Target Start/End: Original strand, 20660961 - 20661002
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcctt |
238 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
20660961 |
ttttggtccctgcaaatatgcctcgttttggttttagtcctt |
20661002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #177
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 197 - 237
Target Start/End: Complemental strand, 2636980 - 2636940
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcct |
237 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
2636980 |
ttttggtccctgcaaatatgcctcgttttggttttagtcct |
2636940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #178
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 124 - 180
Target Start/End: Original strand, 21050575 - 21050631
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||| |||| |||||| |||||||| |||||||| ||||||||||||| |
|
|
| T |
21050575 |
ggctaaaatatgattttagtccctacaaatatgcttcgttttgattttagtccctgt |
21050631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #179
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 137 - 180
Target Start/End: Complemental strand, 1286974 - 1286931
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| |||||||| |
|
|
| T |
1286974 |
ttttggtccctgcaaatatgcctcattttggttttggtccctgt |
1286931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #180
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 124 - 155
Target Start/End: Original strand, 9588358 - 9588389
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatat |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
9588358 |
ggctaaaatatggttttggtccctgcaaatat |
9588389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #181
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 122 - 176
Target Start/End: Complemental strand, 10830899 - 10830844
Alignment:
| Q |
122 |
taggctaaaatatggtttt-ggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||| || ||||||||||||||| |
|
|
| T |
10830899 |
taggctaaaatatgatttttggtccctgcaaatatgccttattttggttttagtcc |
10830844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #182
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Original strand, 18258175 - 18258214
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
18258175 |
ttttggtccctgcaaatatggctcattttggttttagtcc |
18258214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #183
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 19685367 - 19685328
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
19685367 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
19685328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #184
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Original strand, 20985738 - 20985777
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
20985738 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
20985777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #185
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 125 - 180
Target Start/End: Complemental strand, 22551318 - 22551263
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||| ||| ||| |||||||| | ||||||||||||||| |||| |
|
|
| T |
22551318 |
gctaaaatatggttttagtctctgtaaatatgttttgttttggttttagtctctgt |
22551263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #186
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 24443731 - 24443692
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
24443731 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
24443692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #187
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 122 - 169
Target Start/End: Original strand, 31602141 - 31602188
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggtt |
169 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||| ||||||||||| |
|
|
| T |
31602141 |
taggctaaaatatagttttgatccctgcaaatatgcatcgttttggtt |
31602188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #188
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Original strand, 38170527 - 38170566
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
38170527 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
38170566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #189
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 1105075 - 1105033
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||||| |
|
|
| T |
1105075 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
1105033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #190
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 11935897 - 11935855
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||| ||||||| |
|
|
| T |
11935897 |
ttttggtccctgcaaatacgtctcgttttgatttttgtccctg |
11935855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #191
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 15916359 - 15916401
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||| ||||||| |
|
|
| T |
15916359 |
ttttggtccttacaaatatgtctcgttttggttttggtccctg |
15916401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #192
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 20661021 - 20661063
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||| ||||||| |
|
|
| T |
20661021 |
ttttggtccttgcagatatgtctcgttttggttttggtccctg |
20661063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #193
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 197 - 231
Target Start/End: Complemental strand, 28871981 - 28871947
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggtttt |
231 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
28871981 |
ttttggtccctgcaaatatgcctcgttttggtttt |
28871947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #194
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 126 - 180
Target Start/End: Original strand, 31037397 - 31037451
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||| |||||||||||||| || |||||| |||||||| |||| |
|
|
| T |
31037397 |
ctaaaatatggttttagtccctgcaaatataccttgttttgattttagtctctgt |
31037451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #195
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 121 - 155
Target Start/End: Original strand, 31540493 - 31540527
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatat |
155 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
31540493 |
ttaggctaaaatatgtttttggtccctgcaaatat |
31540527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #196
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 131 - 179
Target Start/End: Original strand, 6118139 - 6118188
Alignment:
| Q |
131 |
atatggttttggtccctgcaaatatgtctcgtttt-ggttttagtccctg |
179 |
Q |
| |
|
|||||||||| ||| ||||||||||| |||||||| |||||||||||||| |
|
|
| T |
6118139 |
atatggttttagtctctgcaaatatgcctcgttttgggttttagtccctg |
6118188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #197
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 197 - 238
Target Start/End: Original strand, 10743737 - 10743778
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcctt |
238 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
10743737 |
ttttagtccctgcaaatatgcctcgttttggttttagtcctt |
10743778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #198
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 197 - 238
Target Start/End: Complemental strand, 13990882 - 13990841
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcctt |
238 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
13990882 |
ttttagtccctgcaaatatgcctcgttttggttttagtcctt |
13990841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #199
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 197 - 238
Target Start/End: Original strand, 16038390 - 16038431
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcctt |
238 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
16038390 |
ttttagtccctgcaaatatgcctcgttttggttttagtcctt |
16038431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #200
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 197 - 238
Target Start/End: Complemental strand, 18046335 - 18046294
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcctt |
238 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
18046335 |
ttttagtccctgcaaatatgcctcgttttggttttagtcctt |
18046294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #201
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 197 - 238
Target Start/End: Complemental strand, 18258514 - 18258473
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcctt |
238 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| |||||| |
|
|
| T |
18258514 |
ttttggtccctgcaaatatgtctcgttttggttttagtcctt |
18258473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #202
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 123 - 172
Target Start/End: Original strand, 22540096 - 22540145
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
172 |
Q |
| |
|
||||||||||||| || ||||||| ||||||||||||| |||| |||||| |
|
|
| T |
22540096 |
aggctaaaatatgattatggtccccgcaaatatgtctcatttttgtttta |
22540145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #203
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 197 - 238
Target Start/End: Original strand, 34125320 - 34125361
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcctt |
238 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
34125320 |
ttttagtccctgcaaatatgcctcgttttggttttagtcctt |
34125361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #204
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 123 - 155
Target Start/End: Original strand, 3936577 - 3936609
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatat |
155 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
3936577 |
aggctaaaatatgtttttggtccctgcaaatat |
3936609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #205
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 124 - 172
Target Start/End: Original strand, 5103648 - 5103696
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
172 |
Q |
| |
|
|||||||||||| ||||||| | || ||||||| ||||||||||||||| |
|
|
| T |
5103648 |
ggctaaaatatgattttggttcatgtaaatatgactcgttttggtttta |
5103696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #206
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 196 - 236
Target Start/End: Complemental strand, 9588599 - 9588559
Alignment:
| Q |
196 |
tttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||| |||| |
|
|
| T |
9588599 |
tttttggtccctgcaaatatgtctcgttttggttttagtcc |
9588559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #207
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 140 - 180
Target Start/End: Complemental strand, 18786349 - 18786309
Alignment:
| Q |
140 |
tggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
18786349 |
tggtccctgcaaatatctggcgttttggttttagtccctgt |
18786309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #208
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 123 - 155
Target Start/End: Complemental strand, 27571189 - 27571157
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatat |
155 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
27571189 |
aggctaaaatatgattttggtccctgcaaatat |
27571157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #209
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 195 - 231
Target Start/End: Original strand, 31602219 - 31602255
Alignment:
| Q |
195 |
gtttttggtccctgcaaatatgcctcattttggtttt |
231 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
31602219 |
gtttttggtccctgcaaatatgtctcgttttggtttt |
31602255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #210
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 122 - 174
Target Start/End: Complemental strand, 31602517 - 31602465
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
174 |
Q |
| |
|
||||||||||||| ||||| || | | |||||||||||||||||| ||||||| |
|
|
| T |
31602517 |
taggctaaaatatagttttagttcatacaaatatgtctcgttttgattttagt |
31602465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #211
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 137 - 177
Target Start/End: Original strand, 32888760 - 32888800
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccc |
177 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||| ||||| |
|
|
| T |
32888760 |
ttttggtccctgcaaatatgccttgttttggttttggtccc |
32888800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #212
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 123 - 155
Target Start/End: Complemental strand, 34911888 - 34911856
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatat |
155 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
34911888 |
aggctaaaatatgattttggtccctgcaaatat |
34911856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #213
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 120 - 176
Target Start/End: Original strand, 38496416 - 38496471
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||||||| ||||| |||| || |||||||||| ||||||||||||||| |
|
|
| T |
38496416 |
tttaggctaaaatatagttttagtccttgtaaatatgtct-attttggttttagtcc |
38496471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 71; Significance: 3e-32; HSPs: 3)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 123 - 236
Target Start/End: Original strand, 82340 - 82453
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||| || ||||||||||||||||||||||||||| || |
|
|
| T |
82340 |
aggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaatatgccttat |
82439 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
82440 |
tttggttttggtcc |
82453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 122 - 180
Target Start/End: Complemental strand, 82708 - 82650
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
82708 |
taggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgt |
82650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 236
Target Start/End: Complemental strand, 82693 - 82654
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
82693 |
ttttggtccctgcaaatatgcctcgttttggttttagtcc |
82654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056 (Bit Score: 67; Significance: 7e-30; HSPs: 5)
Name: scaffold0056
Description:
Target: scaffold0056; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 127 - 236
Target Start/End: Complemental strand, 50075 - 49966
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattttg |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| |||||||||| ||||||||| |
|
|
| T |
50075 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccttgcaaatatgtctcattttg |
49976 |
T |
 |
| Q |
227 |
gttttggtcc |
236 |
Q |
| |
|
|||||||||| |
|
|
| T |
49975 |
gttttggtcc |
49966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 127 - 236
Target Start/End: Complemental strand, 55176 - 55067
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattttg |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| |||||||||| ||||||||| |
|
|
| T |
55176 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccttgcaaatatgtctcattttg |
55077 |
T |
 |
| Q |
227 |
gttttggtcc |
236 |
Q |
| |
|
|||||||||| |
|
|
| T |
55076 |
gttttggtcc |
55067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #3
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 123 - 212
Target Start/End: Original strand, 54814 - 54903
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| ||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
54814 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
54903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 50005 - 49963
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||| ||||||| |
|
|
| T |
50005 |
ttttggtccttgcaaatatgtctcattttggttttggtccctg |
49963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 55106 - 55064
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||| ||||||| |
|
|
| T |
55106 |
ttttggtccttgcaaatatgtctcattttggttttggtccctg |
55064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 66; Significance: 3e-29; HSPs: 3)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 120 - 236
Target Start/End: Complemental strand, 75768 - 75652
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcct |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||| || |
|
|
| T |
75768 |
tttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaatatgtct |
75669 |
T |
 |
| Q |
220 |
cattttggttttggtcc |
236 |
Q |
| |
|
| |||| |||||||||| |
|
|
| T |
75668 |
cttttttgttttggtcc |
75652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 118 - 212
Target Start/End: Original strand, 75353 - 75447
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaa |
212 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
75353 |
attttaggctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
75447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 75691 - 75649
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||| ||||||| |
|
|
| T |
75691 |
ttttggtccctgcaaatatgtctcttttttgttttggtccctg |
75649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160 (Bit Score: 61; Significance: 3e-26; HSPs: 3)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 120 - 180
Target Start/End: Complemental strand, 27368 - 27308
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27368 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
27308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 118 - 236
Target Start/End: Original strand, 26994 - 27111
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgc |
217 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||||||||||| |||||| ||| ||| || ||||||||||||||||||||||||| |
|
|
| T |
26994 |
attttaggctcaaatttggttttggtccctgcaaatatgtctcgtttt-gttttaatccttgtaattttttgtttttgtttttggtccctgcaaatatgc |
27092 |
T |
 |
| Q |
218 |
ctcattttggttttggtcc |
236 |
Q |
| |
|
||| ||||||||||||||| |
|
|
| T |
27093 |
ctcgttttggttttggtcc |
27111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 137 - 179
Target Start/End: Original strand, 27072 - 27114
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
27072 |
ttttggtccctgcaaatatgcctcgttttggttttggtccctg |
27114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 57; Significance: 6e-24; HSPs: 7)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 123 - 179
Target Start/End: Original strand, 47924 - 47980
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47924 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
47980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 119 - 176
Target Start/End: Complemental strand, 223177 - 223120
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
223177 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcactttggttttagtcc |
223120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 127 - 180
Target Start/End: Complemental strand, 48228 - 48175
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
| T |
48228 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtctctgt |
48175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #4
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 128 - 236
Target Start/End: Original strand, 222817 - 222923
Alignment:
| Q |
128 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcattttgg |
227 |
Q |
| |
|
|||||||| |||| |||||| ||||||| ||| |||||||||||||| ||||| || ||||||||||||||||||||||| ||| |||||| |
|
|
| T |
222817 |
aaaatatgattttagtccctccaaatatttcttgttttggttttagttcctgtaatttttgttt--tgtttttggtccctgcaaatatgtctcgttttgg |
222914 |
T |
 |
| Q |
228 |
ttttggtcc |
236 |
Q |
| |
|
||||||||| |
|
|
| T |
222915 |
ttttggtcc |
222923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #5
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 137 - 178
Target Start/End: Original strand, 222884 - 222925
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
222884 |
ttttggtccctgcaaatatgtctcgttttggttttggtccct |
222925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #6
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 197 - 231
Target Start/End: Complemental strand, 48218 - 48184
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggtttt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
48218 |
ttttggtccctgcaaatatgcctcattttggtttt |
48184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 197 - 237
Target Start/End: Complemental strand, 223159 - 223119
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcct |
237 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||| ||||| |
|
|
| T |
223159 |
ttttggtccctgcaaatatgtctcactttggttttagtcct |
223119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 57; Significance: 6e-24; HSPs: 2)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 124 - 180
Target Start/End: Complemental strand, 148282 - 148226
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
148282 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
148226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 123 - 236
Target Start/End: Original strand, 147889 - 147999
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||||||| |||||||||||| || |||||||||||||| ||||||||||||||| |
|
|
| T |
147889 |
aggctaaaatatggttttg-tccctgcaaatat--ctcgttttagttttagtccctacaaaaaaaatttgttgtttttggtcccagcaaatatgcctcat |
147985 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
147986 |
tttggttttggtcc |
147999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326 (Bit Score: 55; Significance: 1e-22; HSPs: 4)
Name: scaffold0326
Description:
Target: scaffold0326; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 118 - 176
Target Start/End: Original strand, 4035 - 4093
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
4035 |
attttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
4093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 118 - 176
Target Start/End: Original strand, 19217 - 19275
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
19217 |
attttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
19275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 176
Target Start/End: Complemental strand, 4289 - 4236
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4289 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtcc |
4236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #4
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 176
Target Start/End: Complemental strand, 19471 - 19418
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
19471 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtcc |
19418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119 (Bit Score: 54; Significance: 4e-22; HSPs: 2)
Name: scaffold0119
Description:
Target: scaffold0119; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 124 - 236
Target Start/End: Original strand, 16724 - 16835
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnntta-ttgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| ||| |||||||| ||| ||||||||||| ||||| |
|
|
| T |
16724 |
ggctaaaatatgattttggtccctgcaaatatatctcgttttggttttagtccctgt--aatttttttagttgttttttgtcactgcaaatatgtctcat |
16821 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
16822 |
tttggttttggtcc |
16835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 123 - 171
Target Start/End: Complemental strand, 17097 - 17048
Alignment:
| Q |
123 |
aggctaaa-atatggttttggtccctgcaaatatgtctcgttttggtttt |
171 |
Q |
| |
|
|||||||| ||||| ||||||||| || |||||||||||||||||||||| |
|
|
| T |
17097 |
aggctaaatatatgattttggtccatgtaaatatgtctcgttttggtttt |
17048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085 (Bit Score: 54; Significance: 4e-22; HSPs: 2)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 120 - 236
Target Start/End: Complemental strand, 35088 - 34973
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcct |
219 |
Q |
| |
|
|||||||||||||||||||||| ||| | |||||||||||||||||||||||||||||||| || ||||||||| |||||| ||||||| || |
|
|
| T |
35088 |
tttaggctaaaatatggttttgatccgtacaaatatgtctcgttttggttttagtccctgtaatttttgttt-ttgtttttgatccctgtaaatatgtct |
34990 |
T |
 |
| Q |
220 |
cattttggttttggtcc |
236 |
Q |
| |
|
| ||||||||||||||| |
|
|
| T |
34989 |
cgttttggttttggtcc |
34973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 179
Target Start/End: Complemental strand, 35012 - 34970
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
35012 |
ttttgatccctgtaaatatgtctcgttttggttttggtccctg |
34970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: scaffold0811
Description:
Target: scaffold0811; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 123 - 179
Target Start/End: Original strand, 1310 - 1366
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1310 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
1366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 1645 - 1589
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1645 |
aggctaaaatatgaatttagtccctgcaaatatgcctcgttttggttttagtccctg |
1589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: scaffold0370
Description:
Target: scaffold0370; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 290 - 234
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
290 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 120 - 180
Target Start/End: Complemental strand, 3295 - 3235
Alignment:
| Q |
120 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3295 |
tttaggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgt |
3235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684 (Bit Score: 52; Significance: 6e-21; HSPs: 2)
Name: scaffold0684
Description:
Target: scaffold0684; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 119 - 178
Target Start/End: Complemental strand, 2665 - 2606
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
2665 |
ttttaggctaaaatatggttttggtccctgcaaatatgccttgttttggttttagtccct |
2606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 122 - 172
Target Start/End: Original strand, 2332 - 2382
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
172 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
2332 |
taggctataatatggttttggtccctgcaaatattccttgttttggtttta |
2382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 52; Significance: 6e-21; HSPs: 2)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 117 - 180
Target Start/End: Complemental strand, 366280 - 366217
Alignment:
| Q |
117 |
gattttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
366280 |
gatttaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
366217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 124 - 180
Target Start/End: Original strand, 365979 - 366035
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| ||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
365979 |
ggctaaaatatggttttaatccttgcaaatatgcctcgttttggttttagtccctgt |
366035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210 (Bit Score: 51; Significance: 2e-20; HSPs: 2)
Name: scaffold0210
Description:
Target: scaffold0210; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 122 - 180
Target Start/End: Original strand, 14695 - 14753
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14695 |
taggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
14753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 15013 - 14956
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
15013 |
aggctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccctgt |
14956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0166 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: scaffold0166
Description:
Target: scaffold0166; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 122 - 180
Target Start/End: Original strand, 24370 - 24428
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
24370 |
taggctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtccctgt |
24428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1001 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: scaffold1001
Description:
Target: scaffold1001; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 2777 - 2834
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2777 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
2834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535 (Bit Score: 49; Significance: 4e-19; HSPs: 2)
Name: scaffold0535
Description:
Target: scaffold0535; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 124 - 180
Target Start/End: Complemental strand, 9028 - 8972
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9028 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
8972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 126 - 180
Target Start/End: Original strand, 8734 - 8788
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8734 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
8788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0337 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: scaffold0337
Description:
Target: scaffold0337; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 124 - 176
Target Start/End: Original strand, 12525 - 12577
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
12525 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
12577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065 (Bit Score: 49; Significance: 4e-19; HSPs: 2)
Name: scaffold0065
Description:
Target: scaffold0065; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 124 - 176
Target Start/End: Original strand, 3532 - 3584
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3532 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
3584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 180
Target Start/End: Complemental strand, 3919 - 3862
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3919 |
aggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgt |
3862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051 (Bit Score: 49; Significance: 4e-19; HSPs: 2)
Name: scaffold0051
Description:
Target: scaffold0051; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 123 - 179
Target Start/End: Complemental strand, 5709 - 5653
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5709 |
aggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccctg |
5653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 123 - 175
Target Start/End: Original strand, 5398 - 5450
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
175 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| || ||||||||||||||| |
|
|
| T |
5398 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtc |
5450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078 (Bit Score: 47; Significance: 6e-18; HSPs: 2)
Name: scaffold0078
Description:
Target: scaffold0078; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 122 - 236
Target Start/End: Original strand, 3750 - 3863
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctca |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | |||||||||||| ||||||| || | ||||||||||| |||||||||| |||| |
|
|
| T |
3750 |
taggctaaaatatggttttggtccctgcaaatatgctttgttttggttttaatccctgt-aaaaaaatttgtcgtttttggtccatgcaaatatgtctca |
3848 |
T |
 |
| Q |
222 |
ttttggttttggtcc |
236 |
Q |
| |
|
||||| ||||||||| |
|
|
| T |
3849 |
ttttgattttggtcc |
3863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 122 - 175
Target Start/End: Complemental strand, 4081 - 4028
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
175 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4081 |
taggctaaaatacggttttggtccctgcaaatatgtctcgttttagttttagtc |
4028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 47; Significance: 6e-18; HSPs: 2)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 122 - 180
Target Start/End: Complemental strand, 10517 - 10459
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
10517 |
taggctaaaatatggttttagtccctgcaaatatgtctggttttggttttagttcctgt |
10459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 124 - 176
Target Start/End: Original strand, 10168 - 10220
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| || |||||||||||||||| |
|
|
| T |
10168 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtcc |
10220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 47; Significance: 6e-18; HSPs: 3)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 124 - 178
Target Start/End: Complemental strand, 2883 - 2829
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
2883 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttgagtttagtccct |
2829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 122 - 178
Target Start/End: Original strand, 2499 - 2555
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||| ||||||||||| |
|
|
| T |
2499 |
taggctaaaatatggttttgatccctgcaaatatgcttcgttttgattttagtccct |
2555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 137 - 170
Target Start/End: Original strand, 2576 - 2609
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttt |
170 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |
|
|
| T |
2576 |
ttttggtacctgcaaatatgtctcgttttggttt |
2609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0712 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: scaffold0712
Description:
Target: scaffold0712; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 5208 - 5265
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
5208 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctgt |
5265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0709 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: scaffold0709
Description:
Target: scaffold0709; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 180
Target Start/End: Original strand, 5228 - 5285
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
5228 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctgt |
5285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0123 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: scaffold0123
Description:
Target: scaffold0123; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 119 - 180
Target Start/End: Complemental strand, 18048 - 17987
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |||||| |||||||||| |||||||||||| |
|
|
| T |
18048 |
ttttaggctaaaatatggttttagtccctgcgaatatgcctcgttttggatttagtccctgt |
17987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 176
Target Start/End: Original strand, 8329 - 8382
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8329 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc |
8382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 123 - 176
Target Start/End: Complemental strand, 8643 - 8590
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8643 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc |
8590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0373 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: scaffold0373
Description:
Target: scaffold0373; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 123 - 179
Target Start/End: Original strand, 8546 - 8602
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8546 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
8602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 45; Significance: 9e-17; HSPs: 3)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 124 - 180
Target Start/End: Original strand, 12182 - 12238
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
12182 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtccctgt |
12238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 124 - 176
Target Start/End: Complemental strand, 12536 - 12484
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
12536 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtcc |
12484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 197 - 238
Target Start/End: Complemental strand, 12523 - 12482
Alignment:
| Q |
197 |
ttttggtccctgcaaatatgcctcattttggttttggtcctt |
238 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
12523 |
ttttagtccctgcaaatatgcctcgttttggttttagtcctt |
12482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 45; Significance: 9e-17; HSPs: 5)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 122 - 213
Target Start/End: Original strand, 94055 - 94146
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaat |
213 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||| ||||||||||||||| ||||||| || ||||||||||||||||||||| |
|
|
| T |
94055 |
taggctaaaatatggttttagtccctacaaatatgcctcgttttggttttaatccctgtaaatttttgtttttgtttttggtccctgcaaat |
94146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 125 - 172
Target Start/End: Complemental strand, 94329 - 94282
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
172 |
Q |
| |
|
|||||||||||||||| |||||| |||||||| ||||||||||||||| |
|
|
| T |
94329 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggtttta |
94282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 117 - 155
Target Start/End: Complemental strand, 376435 - 376397
Alignment:
| Q |
117 |
gattttaggctaaaatatggttttggtccctgcaaatat |
155 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
376435 |
gattttaggctaaaatatgcttttggtccctgcaaatat |
376397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 121 - 179
Target Start/End: Original strand, 344934 - 344992
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||| | |||| |||||| ||||||| |
|
|
| T |
344934 |
ttaggctcaaatatgattttggtccctgcaaatatggcgagtttgggttttggtccctg |
344992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 121 - 155
Target Start/End: Complemental strand, 345959 - 345925
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaatat |
155 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
345959 |
ttaggctaaaatatgtttttggtccctgcaaatat |
345925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0159 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: scaffold0159
Description:
Target: scaffold0159; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 124 - 179
Target Start/End: Original strand, 34931 - 34986
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||||||| || ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34931 |
ggctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtccctg |
34986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 3)
Name: scaffold0176
Description:
Target: scaffold0176; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 123 - 176
Target Start/End: Complemental strand, 22056 - 22003
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||||||||||||||||| ||||| || ||||||||||||||||||| |
|
|
| T |
22056 |
aggctaaaatatggttttggtcccttcaaatttgcctcgttttggttttagtcc |
22003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 123 - 236
Target Start/End: Original strand, 21695 - 21802
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctcat |
222 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||| ||| || ||| || || ||||||||||||||||||||| ||| | |
|
|
| T |
21695 |
aggctaaaatatggttttgatccctgcaaatatgt-tcgttttggtattaatctttgt-----aatatttttttttttggtccctgcaaatatgtctcgt |
21788 |
T |
 |
| Q |
223 |
tttggttttggtcc |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
21789 |
tttggttttggtcc |
21802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 137 - 178
Target Start/End: Original strand, 21763 - 21804
Alignment:
| Q |
137 |
ttttggtccctgcaaatatgtctcgttttggttttagtccct |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
21763 |
ttttggtccctgcaaatatgtctcgttttggttttggtccct |
21804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: scaffold0347
Description:
Target: scaffold0347; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 124 - 176
Target Start/End: Complemental strand, 4312 - 4260
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
176 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
4312 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttgagtcc |
4260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 131 - 179
Target Start/End: Original strand, 4016 - 4064
Alignment:
| Q |
131 |
atatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
|||||||||| |||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
4016 |
atatggttttagtccctacaaatatgcctcgttttggttttagtccctg |
4064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0339 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0339
Description:
Target: scaffold0339; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 118 - 174
Target Start/End: Complemental strand, 3461 - 3405
Alignment:
| Q |
118 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
174 |
Q |
| |
|
||||| ||||||||||| ||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
3461 |
atttttggctaaaatatagttttagttcctgcaaatatgtctcgttttggttttagt |
3405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: scaffold0105
Description:
Target: scaffold0105; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 124 - 180
Target Start/End: Complemental strand, 17966 - 17910
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||| ||||| ||||||||| |
|
|
| T |
17966 |
ggctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtccctgt |
17910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 125 - 180
Target Start/End: Original strand, 17651 - 17706
Alignment:
| Q |
125 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgt |
180 |
Q |
| |
|
||||||||||| |||| ||||| ||||||||||| ||||| |||||||||||||| |
|
|
| T |
17651 |
gctaaaatatgattttaatccctacaaatatgtcttgttttagttttagtccctgt |
17706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0578 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: scaffold0578
Description:
Target: scaffold0578; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 127 - 174
Target Start/End: Complemental strand, 5067 - 5020
Alignment:
| Q |
127 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
174 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
5067 |
taaaatatggttttggtctctgcaaatatatctcgttttggttttagt |
5020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 3)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 122 - 236
Target Start/End: Original strand, 189327 - 189440
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtnnnnnnnnnttattgtttttggtccctgcaaatatgcctca |
221 |
Q |
| |
|
||||||||||||| |||||| | |||| ||||||| ||||||||||||||||| | ||| || |||||||| || |||||||||||| |||| |
|
|
| T |
189327 |
taggctaaaatatagttttgattcctgtaaatatgcctcgttttggttttagttcttgt-gatattttttgttgtttttagttcctgcaaatatgactca |
189425 |
T |
 |
| Q |
222 |
ttttggttttggtcc |
236 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
189426 |
ttttggttttggtcc |
189440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 123 - 179
Target Start/End: Original strand, 61631 - 61687
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
179 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
61631 |
aggctaaaatatggtattggtccctgcaaatatgcacagttttgattttagtccctg |
61687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 123 - 172
Target Start/End: Complemental strand, 189679 - 189630
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
172 |
Q |
| |
|
|||||||||||| ||||| ||| ||||||||||| ||| ||||||||||| |
|
|
| T |
189679 |
aggctaaaatatagtttttgtcgctgcaaatatgcctcattttggtttta |
189630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0472 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0472
Description:
Target: scaffold0472; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 123 - 172
Target Start/End: Complemental strand, 7265 - 7216
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
172 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||| |||||||||||| |
|
|
| T |
7265 |
aggctaaaatatgattttggtctctgcaaatatgtcttgttttggtttta |
7216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0204 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: scaffold0204
Description:
Target: scaffold0204; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 126 - 174
Target Start/End: Original strand, 17126 - 17174
Alignment:
| Q |
126 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
174 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| | |||||||||||||| |
|
|
| T |
17126 |
ctaaaatatggttttggtccctccaaatatgtttggttttggttttagt |
17174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0106 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: scaffold0106
Description:
Target: scaffold0106; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 122 - 155
Target Start/End: Complemental strand, 30968 - 30935
Alignment:
| Q |
122 |
taggctaaaatatggttttggtccctgcaaatat |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
30968 |
taggctaaaatatggttttggtccctgcaaatat |
30935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0106; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 121 - 154
Target Start/End: Original strand, 29726 - 29759
Alignment:
| Q |
121 |
ttaggctaaaatatggttttggtccctgcaaata |
154 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |
|
|
| T |
29726 |
ttaggctaaaatatgcttttggtccctgcaaata |
29759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 124 - 172
Target Start/End: Complemental strand, 44206 - 44158
Alignment:
| Q |
124 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
172 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| || ||||||||||| |
|
|
| T |
44206 |
ggctaaaatatggctttggtccctgcaaatatgcttcattttggtttta |
44158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 198 - 231
Target Start/End: Complemental strand, 44192 - 44159
Alignment:
| Q |
198 |
tttggtccctgcaaatatgcctcattttggtttt |
231 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |
|
|
| T |
44192 |
tttggtccctgcaaatatgcttcattttggtttt |
44159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0562 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0562
Description:
Target: scaffold0562; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 119 - 155
Target Start/End: Original strand, 9917 - 9953
Alignment:
| Q |
119 |
ttttaggctaaaatatggttttggtccctgcaaatat |
155 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
9917 |
ttttaggctaaaatatgcttttgatccctgcaaatat |
9953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0517 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0517
Description:
Target: scaffold0517; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 123 - 155
Target Start/End: Complemental strand, 11582 - 11550
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatat |
155 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
11582 |
aggctaaaatatgtttttggtccctgcaaatat |
11550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 123 - 155
Target Start/End: Original strand, 202578 - 202610
Alignment:
| Q |
123 |
aggctaaaatatggttttggtccctgcaaatat |
155 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
202578 |
aggctaaaatatgcttttggtccctgcaaatat |
202610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University