View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10876_low_11 (Length: 239)

Name: NF10876_low_11
Description: NF10876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10876_low_11
NF10876_low_11
[»] chr1 (1 HSPs)
chr1 (1-224)||(1640735-1640959)


Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 1640735 - 1640959
Alignment:
Q  1 gatgctaaactagttcaggtgagttatacggtaattggaacgtagattacggtttttgctaattaagtctcaatcaaaacgccatagtaagttaccaacc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1640735 gatgctaaactagttcaggtgagttatacggtaattggaacgtagattacggtttttgctaattaagtctcaatcaaaacgccatagtaagttaccaacc 1640834  T
Q  101 agcttctgcaggtaaactcaaatgcataaataccaatcttctgattgagggagaaatcgaaccagtcttatctacatcaattctttaatattttgca--a 198  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||  |    
T  1640835 agcttctgcgggtaaactcaaatgcataaataccaatcttctgattgagggagaaatcgaaccagtcttatctacatcaattctttaa-attttgcaaga 1640933  T
Q  199 ccatcgcaatgtgatttacactaact 224  Q
    ||||||||||||||||||||||||||    
T  1640934 ccatcgcaatgtgatttacactaact 1640959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University