View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10875_high_3 (Length: 250)

Name: NF10875_high_3
Description: NF10875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10875_high_3
NF10875_high_3
[»] chr1 (1 HSPs)
chr1 (1-246)||(35890043-35890291)


Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 35890043 - 35890291
Alignment:
Q  1 tgcggcagctttcggcttcacagc---agctttcgcctttggcttagttgcagccttagcggctggcttggtaacagccttagccttcttagcaggagca 97  Q
    ||||||||||||||||||||||||   |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35890043 tgcggcagctttcggcttcacagcagcagctttcgcctttggcttagttgcagccttagcggctggcttggtaacagccttagccttcttagcaggagca 35890142  T
Q  98 atagcggccttcaccggagcagttttggccacagctggggcgattttgaaggagtttttcaccttgacgagctttccagaagccacagatttcttcagat 197  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||    
T  35890143 atagcggccttcaccggagcagttttggccacagctggggcgattttgaaggagtttttcaccttcacaagctttccagaagccacagatttcttcagat 35890242  T
Q  198 gaagaagaatgagtttgcggaatgttggagataaatccctttgcttctc 246  Q
    |||||||||||||||||||||||||||||||||||||| | ||||||||    
T  35890243 gaagaagaatgagtttgcggaatgttggagataaatccttatgcttctc 35890291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University