View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1086_low_21 (Length: 251)

Name: NF1086_low_21
Description: NF1086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1086_low_21
NF1086_low_21
[»] chr2 (2 HSPs)
chr2 (1-142)||(41028150-41028291)
chr2 (171-212)||(41028110-41028151)


Alignment Details
Target: chr2 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 142
Target Start/End: Complemental strand, 41028291 - 41028150
Alignment:
Q  1 tcctcagtttcaaaacatctcattcaatcgcagagaataagttattcgcaattgcattgcagattacttagcaaaaatggaaaaattgcattgtttagac 100  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  41028291 tcctcggtttcaaaacatctcattcaatcgcagagaataagttattcgcaattgcactgcagattacttagcaaaaatggaaaaattgcattgtttagac 41028192  T
Q  101 attgcaacagatgcagagtttcaaatcaaaactacaacctaa 142  Q
    |||||||||||||||||||||||||||||||||| |||||||    
T  41028191 attgcaacagatgcagagtttcaaatcaaaactaaaacctaa 41028150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 171 - 212
Target Start/End: Complemental strand, 41028151 - 41028110
Alignment:
Q  171 aatactaaagtttggtttcagtgaagatttaatattgtgaat 212  Q
    ||||||||||||||||||||||||||||| ||||||||||||    
T  41028151 aatactaaagtttggtttcagtgaagattcaatattgtgaat 41028110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University