View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10862_low_33 (Length: 240)

Name: NF10862_low_33
Description: NF10862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10862_low_33
NF10862_low_33
[»] chr5 (1 HSPs)
chr5 (1-154)||(20870208-20870363)


Alignment Details
Target: chr5 (Bit Score: 92; Significance: 8e-45; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 1 - 154
Target Start/End: Complemental strand, 20870363 - 20870208
Alignment:
Q  1 aatcagaagaaacccaaagttaccttgcttgtgctagcaaatc-nnnnnnnnnnnnnnnnctt-aaagaatgagtaatgtagagaagaaggaggctttaa 98  Q
    |||||||||||||||||||||||||||||||||||||||||||                 ||| ||||||||||||||||||||||||||||||||||||    
T  20870363 aatcagaagaaacccaaagttaccttgcttgtgctagcaaatcaaaaaaataaaaaaaaacttgaaagaatgagtaatgtagagaagaaggaggctttaa 20870264  T
Q  99 ggagaatgttagagaatgatgaagaaactgataaagatccttcttctgctgatctg 154  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  20870263 ggagaatgttagagaatgatgaagaaactgataaagatccttcttctgctgatctg 20870208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University