View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10855A_low_534 (Length: 216)

Name: NF10855A_low_534
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10855A_low_534
NF10855A_low_534
[»] chr7 (1 HSPs)
chr7 (13-188)||(9897822-9897997)


Alignment Details
Target: chr7 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 13 - 188
Target Start/End: Original strand, 9897822 - 9897997
Alignment:
Q  13 tggacatcattatgaagcatgaccgaacaaggtttagcttcccctgcaccttggtttggatctaagacaatgtagatatttaccagcacgactaaattac 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||  ||| |    
T  9897822 tggacatcattatgaagcatgaccgaacaaggtttagcttcccctgccccttggtttggatctaagacaatgtagatatttaccagcacgactccattgc 9897921  T
Q  113 actggggtggctagccctgatgacaagtcaattgtttgtattacatccctattatagcctagccatttttgaatat 188  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  9897922 actggggtggctagccctgatgacaagtcaattgtttgtattacatccctattatagcctagccatttttgaatat 9897997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University