View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10855A_low_506 (Length: 223)

Name: NF10855A_low_506
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10855A_low_506
NF10855A_low_506
[»] chr2 (1 HSPs)
chr2 (18-205)||(11565499-11565686)


Alignment Details
Target: chr2 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 18 - 205
Target Start/End: Complemental strand, 11565686 - 11565499
Alignment:
Q  18 gacatgaacgacggaaatggcgcagattgtggtgggttatggggaacagaggattaactgcgttgtggtagttcgggttcgtcgaagaagttgtgtttca 117  Q
    |||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  11565686 gacatgaacgacggaaatggcgcagattgtggtgagtaatggggaacagaggattaactgcgttgtggtagttcgggttcgtcgaagaagttgtgtttca 11565587  T
Q  118 cgtgaatggatagataataggtattgataactgattgagtaaagaagaaacaagtgtttaattccaacaatttgtagtgcacttgcat 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  11565586 cgtgaatggatagataataggtattgataactgattgagtaaagaagaaacaagtgtttaattccaacaatttgtagtgcacttgcat 11565499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University