View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10855A_low_470 (Length: 229)

Name: NF10855A_low_470
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10855A_low_470
NF10855A_low_470
[»] chr1 (1 HSPs)
chr1 (109-211)||(5230326-5230428)
[»] chr2 (2 HSPs)
chr2 (118-195)||(17125401-17125478)
chr2 (108-177)||(42989374-42989443)
[»] chr4 (1 HSPs)
chr4 (17-77)||(52549112-52549172)


Alignment Details
Target: chr1 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 109 - 211
Target Start/End: Original strand, 5230326 - 5230428
Alignment:
Q  109 tagatagaaaatgagtatggaccagtggagtgggaaattggtgctcctggaaaagcttataccaaatggtttgctcaaatggctgtaagtttagatactg 208  Q
    ||||| || |||||||||||||| ||||| ||||||||||||||||||||||| ||||| || ||||||  |||||||||||||||| || |||||||||    
T  5230326 tagattgagaatgagtatggacctgtggaatgggaaattggtgctcctggaaaggcttacacaaaatgggctgctcaaatggctgtaggtctagatactg 5230425  T
Q  209 gtg 211  Q
    |||    
T  5230426 gtg 5230428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 118 - 195
Target Start/End: Original strand, 17125401 - 17125478
Alignment:
Q  118 aatgagtatggaccagtggagtgggaaattggtgctcctggaaaagcttataccaaatggtttgctcaaatggctgta 195  Q
    |||||||||||||||||||| |||||||||||||| ||||||||| |||| |||||||||||| ||||||||||||||    
T  17125401 aatgagtatggaccagtggaatgggaaattggtgcacctggaaaatcttacaccaaatggttttctcaaatggctgta 17125478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 177
Target Start/End: Complemental strand, 42989443 - 42989374
Alignment:
Q  108 gtagatagaaaatgagtatggaccagtggagtgggaaattggtgctcctggaaaagcttataccaaatgg 177  Q
    |||||| |||||||| ||||||||  ||||||  ||||||||||||||||| ||| | || |||||||||    
T  42989443 gtagattgaaaatgaatatggacctatggagtatgaaattggtgctcctggtaaatcctacaccaaatgg 42989374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 17 - 77
Target Start/End: Complemental strand, 52549172 - 52549112
Alignment:
Q  17 ttatattgctagaaaggtttaagctggccaattacattattgcagcaataatgatcataat 77  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
T  52549172 ttatattgctagaaaggtttaagctggccaattacattattgcagtaataatgatcataat 52549112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University