View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10855A_low_411 (Length: 236)

Name: NF10855A_low_411
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10855A_low_411
NF10855A_low_411
[»] scaffold0100 (1 HSPs)
scaffold0100 (11-122)||(49225-49334)


Alignment Details
Target: scaffold0100 (Bit Score: 89; Significance: 5e-43; HSPs: 1)
Name: scaffold0100
Description:

Target: scaffold0100; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 11 - 122
Target Start/End: Complemental strand, 49334 - 49225
Alignment:
Q  11 tgagataggagctagtaaacatctaattgaagtcaaagatgatttttcagtaaccaaaaatggaagtcaacgatgatttattaagaatttcatactagtc 110  Q
    |||||||||||||||||||||||||||||||||||||||||||||  ||||||  ||||||||||||||| |||||||||||||||||||||||||||||    
T  49334 tgagataggagctagtaaacatctaattgaagtcaaagatgattt--cagtaataaaaaatggaagtcaatgatgatttattaagaatttcatactagtc 49237  T
Q  111 cttacttcctct 122  Q
    ||||||||||||    
T  49236 cttacttcctct 49225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University