View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10855A_low_284 (Length: 251)

Name: NF10855A_low_284
Description: NF10855A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10855A_low_284
NF10855A_low_284
[»] chr3 (1 HSPs)
chr3 (20-239)||(14774985-14775204)


Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 20 - 239
Target Start/End: Original strand, 14774985 - 14775204
Alignment:
Q  20 catcaaacaatactagtagttatcatggttcaaaggggagaggtgataaatcaaagataggtaaaggctttcagcatgctgcttcttcagggaccgggaa 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  14774985 catcaaacaatactagtagttatcatggttcaaaggggagaggtgataaatcaaagataggtaaaggctttcagcatgctgcttcttcagggaccgggaa 14775084  T
Q  120 gtcagaggtggctcccagtattcctttcaataattatgacagcagacccttgccacagaggacaagaactcattcaaatcgatttgtcactaaatttgat 219  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
T  14775085 gtcagaggtggctcccagtattcctttcaataattatgacagcagacccttgccacagaggacaagaactcatgcaaatcgatttgtcactaaatttgat 14775184  T
Q  220 agcaacatgcaaactccaaa 239  Q
    ||||||||||||||| ||||    
T  14775185 agcaacatgcaaacttcaaa 14775204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University