View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10851_low_8 (Length: 259)

Name: NF10851_low_8
Description: NF10851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10851_low_8
NF10851_low_8
[»] chr4 (1 HSPs)
chr4 (34-259)||(1025389-1025614)


Alignment Details
Target: chr4 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 34 - 259
Target Start/End: Original strand, 1025389 - 1025614
Alignment:
Q  34 tgatctcaacatttacaacaaccatatccatgttatgctgaatatcttactnnnnnnnnngttatgctgaatatcaaccagaaaaatagtgttgctgttt 133  Q
    |||| ||||||||||||||||||||||||| ||||| ||||||||||||||         ||||||||||||||||||||||||||||||||||||||||    
T  1025389 tgatgtcaacatttacaacaaccatatccaagttattctgaatatcttactaaaaaaaaagttatgctgaatatcaaccagaaaaatagtgttgctgttt 1025488  T
Q  134 tattatgattttttgtcctcgaaatcataacataaagtatcgcaaaaacaatcagaattaaaaattcacctacatggtatcgtatggtatcataaagaaa 233  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1025489 tattatgattttttgtcctcgaaatcataatataaagtatcgcaaaaataatcagaattaaaaattcacctacatggtatcgtatggtatcataaagaaa 1025588  T
Q  234 tgaataaaacttgattgcttttaatt 259  Q
    ||||||||||||||||||||||||||    
T  1025589 tgaataaaacttgattgcttttaatt 1025614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University