View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10851_high_7 (Length: 228)

Name: NF10851_high_7
Description: NF10851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10851_high_7
NF10851_high_7
[»] chr8 (1 HSPs)
chr8 (6-228)||(23628415-23628637)


Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 6 - 228
Target Start/End: Original strand, 23628415 - 23628637
Alignment:
Q  6 gagccatgcggttagttcgtgacacgagacagtgcttgcaccacctctttcttccggttcagttaaaccggattcaagtggcaaaactggacccacggcc 105  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  23628415 gagccatgcggttagttcgtgacacgagacagtgcttgcaccacctctttcttccggttcagttaaaccggattcaagtggcaaaactggacccacggcc 23628514  T
Q  106 cgaactctctcgtgtccaagttctttcttcatatggttcaagtaagccggttctaaatcaatgaaagagttgaaaaccactccccaagcttcatgattaa 205  Q
    | |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  23628515 caaactctctcgtgtccaagttctttcttcatatggtttaagtaagccggttctaaatcaatgaaagagttgaaaaccactccccaagcttcatgattaa 23628614  T
Q  206 atagaaaatcgttttttatattc 228  Q
    ||||||||||||| |||||||||    
T  23628615 atagaaaatcgttctttatattc 23628637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University