View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1084_high_57 (Length: 252)

Name: NF1084_high_57
Description: NF1084
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1084_high_57
NF1084_high_57
[»] chr2 (1 HSPs)
chr2 (63-198)||(1552831-1552966)


Alignment Details
Target: chr2 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 63 - 198
Target Start/End: Complemental strand, 1552966 - 1552831
Alignment:
Q  63 cttccaaccacgtggacactatgttccactccactgtgctctttctatcttttgctattgttgatgttaatttaggtagataaacacaagcaaatgcaaa 162  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1552966 cttccaaccacgtggacactatgttccactccactgtgctctttctatcttttgctattgttgatgttaatttaggtagataaacacaagcaaatgcaaa 1552867  T
Q  163 caaaaaccaatttaatgaagtaagatgtgtctgtgg 198  Q
    ||||||||||||||||||||||||||||||||||||    
T  1552866 caaaaaccaatttaatgaagtaagatgtgtctgtgg 1552831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University