View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10841_low_105 (Length: 234)

Name: NF10841_low_105
Description: NF10841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10841_low_105
NF10841_low_105
[»] chr2 (2 HSPs)
chr2 (1-135)||(41367088-41367222)
chr2 (172-216)||(41367046-41367090)


Alignment Details
Target: chr2 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 1 - 135
Target Start/End: Complemental strand, 41367222 - 41367088
Alignment:
Q  1 gaacacaataattattgcaaaaattaccaagataggattggggcaaaaatttacccctttcatatccaccaactcttctaccttaaccatgtccctcagg 100  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41367222 gaacacaataattattgcaaaaattaccaagataggattggtgcaaaaatttacccctttcatatccaccaactcttctaccttaaccatgtccctcagg 41367123  T
Q  101 attaatatcctcatcaaatttctcttattccttaa 135  Q
    |||||||||||||||||||| ||||||||||||||    
T  41367122 attaatatcctcatcaaattactcttattccttaa 41367088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 172 - 216
Target Start/End: Complemental strand, 41367090 - 41367046
Alignment:
Q  172 taagaccacaattaaagcaaaacatagtgagattcacgtacctaa 216  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
T  41367090 taagaccacaattaaagcaaaacatagtgagattcacgtacctaa 41367046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University