View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10841_low_100 (Length: 239)

Name: NF10841_low_100
Description: NF10841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10841_low_100
NF10841_low_100
[»] chr7 (1 HSPs)
chr7 (1-223)||(47583454-47583679)


Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 47583454 - 47583679
Alignment:
Q  1 acaactaattagaaccaattctattactttttacgatatctt---cagatcatagttcaattgattaaatcatgatttttagtttcttattcagatgaat 97  Q
    ||||||||||||||||||||||||||||||||  ||||||||   ||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
T  47583454 acaactaattagaaccaattctattactttttgtgatatcttcttcagatcatagttcaattgattaaatcatgatttttagtttcttattccgatgaat 47583553  T
Q  98 tgatatgtagttgaatgtaaatgtgatgatgcaggtgacaaattcagggacaggagcacaggaaacagtgagaattgtagatcaatgcagcaatggaggg 197  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  47583554 tgatatgtagttgaatgtaaatgtgatgatgcaggtgacaaattcaggtacaggagcacaggaaacagtgagaattgtagatcaatgcagcaatggaggg 47583653  T
Q  198 ttggatttggatgtgggagtgtttaa 223  Q
    ||||||||||||||||||||||||||    
T  47583654 ttggatttggatgtgggagtgtttaa 47583679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University