View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10831_high_42 (Length: 243)

Name: NF10831_high_42
Description: NF10831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10831_high_42
NF10831_high_42
[»] chr2 (2 HSPs)
chr2 (56-204)||(1359268-1359411)
chr2 (1-38)||(1359216-1359253)


Alignment Details
Target: chr2 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 56 - 204
Target Start/End: Original strand, 1359268 - 1359411
Alignment:
Q  56 tagtgccctcatcgttactcgactatataaactatagtcacatgatcgtgtgcatgccatgcttcctnnnnnnnttgttgtggggattatcccttatttt 155  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||     |||||       ||||||||||||||||||||||||||    
T  1359268 tagtgccctcatcgttactcgactatataaactatagtcacatgatcgtgtgcatgc-----ttcctaaaaaaattgttgtggggattatcccttatttt 1359362  T
Q  156 cttaaataaataaatttaatgacaagaagtggacgatattaagtcctct 204  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
T  1359363 cttaaataaataaatttaatgacaagaagtggacgatattaagtcctct 1359411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 1359216 - 1359253
Alignment:
Q  1 tgatcttgaccaactaaaatagtgccctcatttctctc 38  Q
    ||||||||||||||||||||||||||||||||||||||    
T  1359216 tgatcttgaccaactaaaatagtgccctcatttctctc 1359253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University