View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10829A_low_309 (Length: 249)

Name: NF10829A_low_309
Description: NF10829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10829A_low_309
NF10829A_low_309
[»] chr5 (1 HSPs)
chr5 (11-166)||(41415133-41415288)


Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 11 - 166
Target Start/End: Complemental strand, 41415288 - 41415133
Alignment:
Q  11 gatgaatagatggtcaatacttagcagataaaacattttttcctttattggtttagaacacaagtaaattttttctatgaaagaaggaaactttgtttcc 110  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41415288 gatgaattgatggtcaatacttagcagataaaacattttttcctttattggtttagaacacaagtaaattttttctatgaaagaaggaaactttgtttcc 41415189  T
Q  111 aatttaaaacctatctttagattagtcaaacaagtatcaaatagtttgaagggtgc 166  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41415188 aatttaaaacctatctttagattagtcaaacaagtatcaaatagtttgaagggtgc 41415133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University