View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10821_low_87 (Length: 201)

Name: NF10821_low_87
Description: NF10821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10821_low_87
NF10821_low_87
[»] scaffold0018 (1 HSPs)
scaffold0018 (16-185)||(152965-153134)
[»] chr1 (1 HSPs)
chr1 (16-158)||(41444112-41444254)
[»] chr3 (1 HSPs)
chr3 (45-158)||(32879424-32879537)


Alignment Details
Target: scaffold0018 (Bit Score: 130; Significance: 1e-67; HSPs: 1)
Name: scaffold0018
Description:

Target: scaffold0018; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 16 - 185
Target Start/End: Original strand, 152965 - 153134
Alignment:
Q  16 gatgggtcggtggtgggataacatacgacatgtggtggtattttcagggataacagaggatctttaatgagttgttttgcaggtaatcttggagcattct 115  Q
    |||||||||||||||||| ||||| || |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||    
T  152965 gatgggtcggtggtgggacaacatgcggcatgtggtggtattttcagggataacagaggatctttaatgacttgttttgcaggtaatcttgaagcattct 153064  T
Q  116 caatttttgaggccaaaatctttggttttattatggctatggaaaacgctctgcagcaaggttacatttg 185  Q
    |  ||||||||| |||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||    
T  153065 ctgtttttgaggtcaaaatctttggttttattatggctatggagaacgctctgcaacaaggttacatttg 153134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 71; Significance: 2e-32; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 16 - 158
Target Start/End: Complemental strand, 41444254 - 41444112
Alignment:
Q  16 gatgggtcggtggtgggataacatacgacatgtggtggtattttcagggataacagaggatctttaatgagttgttttgcaggtaatcttggagcattct 115  Q
    ||||||||||||||| || |||||  |||||||||||||||||| ||||| || ||||||||||| ||| |||| |||||||||||| ||||||| ||||    
T  41444254 gatgggtcggtggtgagacaacatgtgacatgtggtggtatttttagggacaatagaggatctttgatgggttgatttgcaggtaatattggagccttct 41444155  T
Q  116 caatttttgaggccaaaatctttggttttattatggctatgga 158  Q
    |  ||||||||||| |||||||||||| |  ||||||||||||    
T  41444154 ctgtttttgaggccgaaatctttggttatgctatggctatgga 41444112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 70; Significance: 9e-32; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 70; E-Value: 9e-32
Query Start/End: Original strand, 45 - 158
Target Start/End: Original strand, 32879424 - 32879537
Alignment:
Q  45 atgtggtggtattttcagggataacagaggatctttaatgagttgttttgcaggtaatcttggagcattctcaatttttgaggccaaaatctttggtttt 144  Q
    ||||||||||||||| ||||| |||||||| ||||| ||| | |||||||||||||||||||||||||||||  ||||||| ||| |||||||| |||||    
T  32879424 atgtggtggtatttttagggacaacagagggtctttgatgggatgttttgcaggtaatcttggagcattctctgtttttgatgccgaaatcttttgtttt 32879523  T
Q  145 attatggctatgga 158  Q
    ||||||||||||||    
T  32879524 attatggctatgga 32879537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University