View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10821_low_86 (Length: 204)

Name: NF10821_low_86
Description: NF10821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10821_low_86
NF10821_low_86
[»] chr5 (1 HSPs)
chr5 (13-186)||(10436054-10436228)


Alignment Details
Target: chr5 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 13 - 186
Target Start/End: Complemental strand, 10436228 - 10436054
Alignment:
Q  13 cataggctagtgaatttggattattttccagctcatatgagatatttcatgttctcaagttgttgtaaaatatgtgactactcaaataccaacaaggcaa 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  10436228 cataggctagtgaatttggattattttccagctcatatgagatatttcatgttctcaagttgttgtaaaatatgtgactactcaaataccaacaaggcaa 10436129  T
Q  113 tcttataaattatcacnnnnnnncatgggatc--atacttgtggacccaatacatatatatatctttggtgaaaaa 186  Q
    ||||||||||||||||       |||||||||  ||||| |||||||||| || ||||||||||||||||||||||    
T  10436128 tcttataaattatcactttttttcatgggatcatatactcgtggacccaacac-tatatatatctttggtgaaaaa 10436054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University