View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10821_low_85 (Length: 206)

Name: NF10821_low_85
Description: NF10821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10821_low_85
NF10821_low_85
[»] chr3 (1 HSPs)
chr3 (46-193)||(25348384-25348531)


Alignment Details
Target: chr3 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 46 - 193
Target Start/End: Complemental strand, 25348531 - 25348384
Alignment:
Q  46 ctcaaatcagttgagctaccaaccccctaaaataagccgtgaaaaataagcatagaccatatgtatgtgtatgttattttttaactagttatttagctca 145  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||| |||||||||||||||    
T  25348531 ctcaaatcagttgagctaccaaccccctaaaataagccgtgaaaaataagtatagaccgtatgtatgtgtatgttattttttaattagttatttagctca 25348432  T
Q  146 atgatcgattaatttagaagaccaatctcacactccgaatgatgtcca 193  Q
    |||| |||||||||||||||| |||||||||||| ||| |||||||||    
T  25348431 atgaccgattaatttagaagatcaatctcacacttcgagtgatgtcca 25348384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University