View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10821_low_38 (Length: 274)

Name: NF10821_low_38
Description: NF10821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10821_low_38
NF10821_low_38
[»] chr7 (1 HSPs)
chr7 (20-261)||(42410061-42410302)


Alignment Details
Target: chr7 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 20 - 261
Target Start/End: Original strand, 42410061 - 42410302
Alignment:
Q  20 gtaataataccagttagtttctagcaatctcatccagcttgttgacttgattgtctttgcagccttactttgtagccgagactacaatgcctgggaagag 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  42410061 gtaataataccagttagtttctagcaatctcatccagcttgttgacttgattgtctttgcagccttactttgtagccgagactacaatgcctgggaagag 42410160  T
Q  120 tgggtttgatttcagaggttcttctcagtcatttaatgtccttgcagagtacctttttggtaaggtagtaatactttttagaaccaagtcacattcgtgc 219  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
T  42410161 tgggtttgatttcagaggttcttctcagtcatttaatgtccttgcagagtacctttttggtaaggtagtaatactttttagaacaaagtcacattcgtgc 42410260  T
Q  220 atttttaaattttactgggttgcttttggttgctgtatctct 261  Q
    |||||| |||||||||||||||||||||||||||||||||||    
T  42410261 attttttaattttactgggttgcttttggttgctgtatctct 42410302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University