View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10821_high_3 (Length: 454)

Name: NF10821_high_3
Description: NF10821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10821_high_3
NF10821_high_3
[»] scaffold0072 (1 HSPs)
scaffold0072 (109-248)||(43471-43610)
[»] chr7 (2 HSPs)
chr7 (55-266)||(7729908-7730119)
chr7 (291-324)||(8972577-8972610)
[»] chr6 (1 HSPs)
chr6 (301-401)||(10995616-10995716)


Alignment Details
Target: scaffold0072 (Bit Score: 44; Significance: 7e-16; HSPs: 1)
Name: scaffold0072
Description:

Target: scaffold0072; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 109 - 248
Target Start/End: Original strand, 43471 - 43610
Alignment:
Q  109 agtcaagataagcatccaattgcgtatttctctaagaaattgaatatttctatgcaacacaaatctgcctatgtcagagagctttatgcagttactgagg 208  Q
    ||||||||||||||||| ||||| || || || |||||| |   |  |||||||||||| |||||||| ||||| || ||  | |||||||| ||||| |    
T  43471 agtcaagataagcatcccattgcttacttttcaaagaaacttgctccttctatgcaacataaatctgcgtatgtgagggaattatatgcagtcactgaag 43570  T
Q  209 ctatggctaaatttagacactatattctgggtcataaatt 248  Q
    ||||||| ||||| |||||||||||||| || ||||||||    
T  43571 ctatggcaaaattcagacactatattctaggccataaatt 43610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 55 - 266
Target Start/End: Original strand, 7729908 - 7730119
Alignment:
Q  55 aagccattcattctagagacagatgcttctggtactggcattggtgctattttgagtcaagataagcatccaattgcgtatttctctaagaaattgaata 154  Q
    ||||| ||||||||||||||||| || || |  ||  |||||||||| ||  | ||||| |||||||  |||||||| || ||||| |||||||| ||      
T  7729908 aagcctttcattctagagacagacgcatccgaaacaagcattggtgccatactcagtcaggataagcccccaattgcttacttctcaaagaaattaaact 7730007  T
Q  155 tttctatgcaacacaaatctgcctatgtcagagagctttatgcagttactgaggctatggctaaatttagacactatattctgggtcataaatttatcat 254  Q
      ||||||||| | |||||||||||||| |||||  |||||  |||  | || || ||||| ||||| ||||| |||||||||||||| ||| |||| ||    
T  7730008 cctctatgcaaaagaaatctgcctatgtgagagaaatttatttagtaccagaagcaatggccaaattcagacattatattctgggtcacaaagttattat 7730107  T
Q  255 cagaactgatca 266  Q
      ||||||||||    
T  7730108 acgaactgatca 7730119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 291 - 324
Target Start/End: Complemental strand, 8972610 - 8972577
Alignment:
Q  291 tcaaactattcaaaccccagaacaacaaaaatgg 324  Q
    ||||||||||||||||||||||||||||||||||    
T  8972610 tcaaactattcaaaccccagaacaacaaaaatgg 8972577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 301 - 401
Target Start/End: Original strand, 10995616 - 10995716
Alignment:
Q  301 caaaccccagaacaacaaaaatggttgcataagtttttgggatttgatttcactattgaatataagccaggcaaggataatattgctgctgatgccttgt 400  Q
    ||||| ||||||||||||  |||||| || |||||| | || ||||||||   ||||||||| |||||||||| |||||| ||| | |||||||||||||    
T  10995616 caaactccagaacaacaagcatggttacacaagtttattggctttgattttcatattgaatacaagccaggcatggataacattccagctgatgccttgt 10995715  T
Q  401 c 401  Q
    |    
T  10995716 c 10995716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University