View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10817_high_3 (Length: 350)

Name: NF10817_high_3
Description: NF10817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10817_high_3
NF10817_high_3
[»] chr3 (2 HSPs)
chr3 (1-96)||(5373416-5373512)
chr3 (123-175)||(5373539-5373590)


Alignment Details
Target: chr3 (Bit Score: 85; Significance: 2e-40; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 1 - 96
Target Start/End: Original strand, 5373416 - 5373512
Alignment:
Q  1 gagagagatgaaagctagatttgaaaggatgaaacagacaggatcggaaaa-acagatgcatatataataggaaacgggagaaagttattagaaaat 96  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
T  5373416 gagaaagatgaaagctagatttgaaaggatgaaacagacaggatcggaaaaaacagatgcatatataataggaaacgggagaaagttattagaaaat 5373512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 123 - 175
Target Start/End: Original strand, 5373539 - 5373590
Alignment:
Q  123 aacacagatgttgatgatgatgtgtctgattgagaaattttaggagatttgag 175  Q
    |||||||||||| ||||||||||||||||||||||||||||| ||||||||||    
T  5373539 aacacagatgtt-atgatgatgtgtctgattgagaaattttacgagatttgag 5373590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University