View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10806_low_15 (Length: 223)

Name: NF10806_low_15
Description: NF10806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10806_low_15
NF10806_low_15
[»] chr7 (1 HSPs)
chr7 (36-210)||(41639444-41639618)


Alignment Details
Target: chr7 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 36 - 210
Target Start/End: Complemental strand, 41639618 - 41639444
Alignment:
Q  36 tgttacacattgaccagaaggaaatgagataaattaatatgataatcgattaattttgtattattataaagaattgaatagtggattgcacgtaaagaac 135  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
T  41639618 tgttacacattgaccagaagaaaatgagataaattaatatgataatcgattaattttgtattattataaagaattgaatagtggattgcacgtcaagaac 41639519  T
Q  136 cgataggagtgcttcaccacgtttattcccaactcatactcacactaaccaacccctgcttagctggcttgttat 210  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
T  41639518 cgataggagtgcttcaccacgtttattcccaattcatactcacactaaccaacccctgcttagctggcttgttat 41639444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University